Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU081611

Sigma-Aldrich

MISSION® esiRNA

targeting human MYH9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGATGCCCCCTCACATCTATGCCATCACAGACACCGCCTACAGGAGTATGATGCAAGACCGAGAAGATCAATCCATCTTGTGCACTGGTGAATCTGGAGCTGGCAAGACGGAGAACACCAAGAAGGTCATCCAGTATCTGGCGTACGTGGCGTCCTCGCACAAGAGCAAGAAGGACCAGGGCGAGCTGGAGCGGCAGCTGCTGCAGGCCAACCCCATCCTGGAGGCCTTCGGGAACGCCAAGACCGTGAAGAATGACAACTCCTCCCGCTTCGGCAAATTCATTCGCATCAACTTTGATGTCAATGGCTACATTGTTGGAGCCAACATTGAGACTTATCTTTTGGAGAAATCTCGTGCTATCCGCCAAGCCAAGGAAGAACGGACCTTCCACATCTTCTATTATCTCCTGTCTGGGGCTGGAGAGCACCTGAAGACC

Ensembl | human accession no.

ENSG00000100345

NCBI accession no.

NM_002473

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYH9(4627) , MYH9(4627)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Bo Yang et al.
Nature materials, 19(2), 239-250 (2019-10-30)
A common feature of cancer cells is the alteration of kinases and biochemical signalling pathways enabling transformed growth on soft matrices, whereas cytoskeletal protein alterations are thought to be a secondary issue. However, we report here that cancer cells from
Satyendra Kumar Singh et al.
Medical oncology (Northwood, London, England), 37(10), 88-88 (2020-09-10)
Non-muscle myosin IIA heavy chain (MYH9) has been implicated in many physiological and pathological functions including cell adhesion, polarity, motility to cancer. However, its role in melanoma remains unexplored. The aim of our study was to evaluate the role of
Jeong Suk Kang et al.
Scientific reports, 9(1), 7679-7679 (2019-05-24)
MYH9, a widely expressed gene encoding nonmuscle myosin heavy chain, is also expressed in podocytes and is associated with glomerular pathophysiology. However, the mechanisms underlying MYH9-related glomerular diseases associated with proteinuria are poorly understood. Therefore, we investigated the role and
Shuli Liang et al.
PloS one, 6(4), e18409-e18409 (2011-05-03)
MicroRNAs (miRNAs) are important regulators that play key roles in tumorigenesis and tumor progression. A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. Through miRNA array, we found that let-7f was downregulated
Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service