Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU050421

Sigma-Aldrich

MISSION® esiRNA

targeting human DPYSL2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGAGCGATCGTCTTCTGATCAAAGGAGGTAAAATTGTTAATGATGACCAGTCGTTCTATGCAGACATATACATGGAAGATGGGTTGATCAAGCAAATAGGAGAAAATCTGATTGTGCCAGGAGGAGTGAAGACCATCGAGGCCCACTCCCGGATGGTGATCCCCGGAGGAATTGACGTCCACACTCGTTTCCAGATGCCTGATCAGGGAATGACGTCTGCTGATGATTTCTTCCAAGGAACCAAGGCGGCCCTGGCTGGGGGAACCACTATGATCATTGACCACGTTGTTCCTGAGCCTGGGACAAGCCTGCTCGCTGCCTTTGACCAGTGGAGGGAATGGGCCGACAGCAAGTCCTGCTGTGACTACTCTCTGCATGTGGACATCAGTGAGTGGCATAAGGGCATCCAGGAGGAGATGGAAGCGCTTGTGAAGGATCACGGGGTAAATTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hervé Husson et al.
Human molecular genetics, 25(11), 2245-2255 (2016-10-30)
Polycystic kidney diseases (PKDs) comprise a subgroup of ciliopathies characterized by the formation of fluid-filled kidney cysts and progression to end-stage renal disease. A mechanistic understanding of cystogenesis is crucial for the development of viable therapeutic options. Here, we identify
Lokesh Agrawal et al.
Neuropharmacology, 158, 107712-107712 (2019-07-22)
Serotonin (5-HT) homeostasis is critical for the brain development which influences neurogenesis, neuronal migration, and circuit formation. Distinctive distribution patterns of serotonin receptors (5-HTRs) in the brain govern various physiological activities. Amongst the 5-HTRs, serotonin 4 receptor (5-HT4R) is widely
Eun J Na et al.
Frontiers in molecular neuroscience, 10, 288-288 (2017-10-03)
Collapsin response mediator protein (CRMP)-2 and the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway are associated with common physiological functions such as neuronal polarity, axonal outgrowth and synaptic strength, as well as various brain disorders including epilepsy. But
Laura Duciel et al.
Scientific reports, 9(1), 2990-2990 (2019-03-01)
Uveal melanoma (UM) is an aggressive tumor in which approximately 50% of patients develop metastasis. Expression of the PTP4A3 gene, encoding a phosphatase, is predictive of poor patient survival. PTP4A3 expression in UM cells increases their migration in vitro and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service