Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU034511

Sigma-Aldrich

MISSION® esiRNA

targeting human TBK1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCGGCTGGTATAACAAGAGGATTGCCTGATCCAGCCAAGATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACTGCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTTAATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAAAAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGACATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAACCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTGGGTGGAATGAAT

Ensembl | human accession no.

ENSG00000183735

NCBI accession no.

NM_013254

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TBK1(29110) , TBK1(29110)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yanyu Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(7), 7822-7832 (2019-03-27)
Platelets can promote several stages of the metastatic process and thus contribute to malignant progression. As an example, platelets promote invasive properties of tumor cells by induction of epithelial to mesenchymal transition (EMT). In this study, we show that tumor
Kaixuan Cui et al.
Biochemical and biophysical research communications, 503(1), 202-208 (2018-06-05)
choroidal neovascularization (CNV), a characteristic of wet age-related macular degeneration (AMD), causes severe vision loss among elderly patients. TANK-binding kinase 1 (TBK1) is a ubiquitously expressed serine-threonine kinase and is found to induce endothelial cells proliferation, represent a novel mediator
Yong Cheng et al.
EMBO reports, 20(3) (2019-01-27)
Extracellular vesicles (EVs) have been shown to carry microbial components and function in the host defense against infections. In this study, we demonstrate that Mycobacterium tuberculosis (M.tb) RNA is delivered into macrophage-derived EVs through an M.tb SecA2-dependent pathway and that
Chaping Cheng et al.
Theranostics, 8(17), 4633-4648 (2018-10-04)
Tumor metastasis is the major cause of death for prostate cancer (PCa) patients. However, the treatment options for metastatic PCa are very limited. Epithelial-mesenchymal transition (EMT) has been reported to be an indispensable step for tumor metastasis and is suggested
Ricardo J Antonia et al.
Scientific reports, 9(1), 13470-13470 (2019-09-19)
While best known for its role in the innate immune system, the TANK-binding kinase 1 (TBK1) is now known to play a role in modulating cellular growth and autophagy. One of the major ways that TBK1 accomplishes this task is
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service