Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU075181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse E2f1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGGATCTGGAGACTGACCATCAGTACCTCGCTGGTAGCAGTGGGCCATTCCGGGGCAGAGGCCGCCACCCAGGGAAAGGTGTGAAATCTCCGGGGGAGAAGTCACGCTATGAAACCTCACTAAATCTGACCACCAAACGCTTCTTGGAGCTGCTGAGCCGCTCAGCTGACGGTGTCGTTGACCTGAACTGGGCAGCTGAGGTGCTGAAGGTGCAGAAACGGCGCATCTATGACATCACCAATGTCCTGGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAATCATATCCAGTGGCTAGGCAGCCACACCATGGTGGGGATTGGTAAGCGGCTTGAAGGCCTGACCCAGGACCTGCAGCAACTGCAGGAGAGTGAGCAGCAGCTGGATCACCTGATGCACATCTGTACCACACAGCTGCAACTGCTTTCGGAGGACTC

Ensembl | Número de adesão de camundongo

ENSMUSG00000027490

nº de adesão NCBI

NM_007891

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... E2F1(13555) , E2f1(13555)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wanghao Chen et al.
Journal of neuro-oncology, 120(1), 43-53 (2014-08-21)
MicroRNAs (miRNAs) have gained much attention due to their critical roles in diverse biological events, including tumorigenesis. In this study, we demonstrate that miR-136 is down-regulated in two cohorts of patients with glioma. Furthermore, the low-level expression of miR-136 is
Xiaolei Jiang et al.
PloS one, 10(6), e0127951-e0127951 (2015-06-04)
The E2F1 transcription factor regulates cell proliferation and apoptosis through the control of a considerable variety of target genes. Previous work has detailed the role of other transcription factors in mediating the specificity of E2F function. Here we identify the
T J Kaitu'u-Lino et al.
Placenta, 36(8), 932-937 (2015-07-07)
Preeclampsia is a serious complication of pregnancy for which there are no efficacious medical treatments. Soluble endoglin is as an anti-angiogenic factor that contributes to the pathogenesis of the disease, however little is known about its molecular regulation in placenta.
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica