Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU033001

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gja3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTTCGAAGTGGGGTTCATCGCGGGCCAGTACTTTCTATACGGCTTCCAGCTGCAGCCACTTTACCGCTGCGACCGCTGGCCCTGCCCCAACACTGTGGACTGTTTCATCTCCAGGCCCACAGAGAAGACCATCTTTGTCATCTTCATGCTGGCTGTGGCCTGTGCGTCACTGGTACTCAACATGCTGGAGATTTACCACCTGGGCTGGAAGAAGCTCAAGCAGGGAGTTACTAACCACTTCAACCCAGATGCCTCAGAAGCCAGGCACAAGCCCTTGGACCCCCTACCCACGGCCACCAGCTCTGGCCCGCCCAGCGTCTCCATCGGGTTCCCACCTTATTACACACACCCTGCCTGTCCCACAGTACAGGCAAAGGCCATAGGGTTTCCTGGGGCCCCACTATCACCAGCAGACTTCACAGTGGTGACTCTAAACGATGCTCAAGGCAGAAACCACCCAGTCAAACACTGCAATGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000048582

nº de adesão NCBI

NM_016975

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... GJA3(14611) , Gja3(14611)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tetsuya Muto et al.
Investigative ophthalmology & visual science, 55(7), 4327-4337 (2014-06-19)
To investigate whether high glucose (HG) alters connexin 43 (Cx43) expression and gap junction intercellular communication (GJIC) activity in retinal Müller cells, and promotes Müller cell and pericyte loss. Retinal Müller cells (rMC-1) and cocultures of rMC-1 and retinal pericytes
Tobias Forster et al.
Oncotarget, 5(6), 1621-1634 (2014-04-20)
The extreme aggressiveness of pancreatic ductal adenocarcinoma (PDA) has been associated with blocked gap junctional intercellular communication (GJIC) and the presence of cancer stem cells (CSCs). We examined whether disturbed GJIC is responsible for a CSC phenotype in established and
Dominique Thuringer et al.
Oncotarget, 6(12), 10267-10283 (2015-04-15)
High levels of circulating heat shock protein 70 (HSP70) are detected in many cancers. In order to explore the effects of extracellular HSP70 on human microvascular endothelial cells (HMEC), we initially used gap-FRAP technique. Extracellular human HSP70 (rhHSP70), but not
Lingzhi Wang et al.
Oncology reports, 34(4), 2133-2141 (2015-08-12)
Cisplatin, an important chemotherapeutic agent against testicular germ cell cancer, induces testicular toxicity on Leydig and Sertoli cells, leading to serious side-effects such as azoospermia and infertility. In a previous study, it was found that simvastatin enhanced the sensitivity of
S Morel et al.
Thrombosis and haemostasis, 112(2), 390-401 (2014-05-16)
Ubiquitous reduction of the gap junction protein Connexin43 (Cx43) in mice provides beneficial effects on progression and composition of atherosclerotic lesions. Cx43 is expressed in multiple atheroma-associated cells but its function in each cell type is not known. To examine
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica