Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU017111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pgp

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGACCCACACTTCAGCTACATGAAGCTCACCAAGGCCGTGCGGTACCTGCAGCAGCCCGACTGTCTGCTCGTGGGCACCAACATGGACAACCGGCTCCCGCTAGAGAACGGCCGTTTCATTGCGGGTACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTTCGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCCTGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTT

Ensembl | Número de adesão de camundongo

ENSMUSG00000043445

nº de adesão NCBI

NM_025954

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... PGP(67078) , Pgp(67078)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hui-Hui Guo et al.
Nature communications, 10(1), 1981-1981 (2019-05-02)
Cardiovascular and metabolic disease (CMD) remains a main cause of premature death worldwide. Berberine (BBR), a lipid-lowering botanic compound with diversified potency against metabolic disorders, is a promising candidate for ameliorating CMD. The liver is the target of BBR so
Hong Yang et al.
Biomaterials science, 6(9), 2426-2439 (2018-07-25)
The efficacy of cancer chemotherapy can be generally restrained by the multiple drug resistance (MDR) of tumors, which is typically attributed to the upregulation of ATP-binding cassette (ABC) transporter proteins, such as P-glycoprotein (P-gp). There is an urgent need to
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR
Anting Jin et al.
Bioactive materials, 5(3), 522-541 (2020-04-24)
Inspired by the mechanism of mussel adhesion, polydopamine (PDA), a versatile polymer for surface modification has been discovered. Owing to its unique properties like extraordinary adhesiveness, excellent biocompatibility, mild synthesis requirements, as well as distinctive drug loading approach, strong photothermal
Nadejda Sigal et al.
Infection and immunity, 83(6), 2358-2368 (2015-04-01)
Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica