Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU157281

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAS1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGGGGCAGTTATGGACACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACTAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACTTAGAGCGGGAGCTGGCAGACCTCCATGGGAAAGATGCCGCACTCTTGTTTTCCTCGTGCTTTGTGGCCAATGACTCAACCCTCTTCACCCTGGCTAAGATGATGCCAGGCTGTGAGATTTACTCTGATTCTGGGAACCATGCCTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTACATCTTCCGCCACAATGATGTCAGCCACCTCAGAGAACTGCTGCAAAGATCTGACCCCTCAGTCCCCAAGATTGTGGCATTTGAAACTGTCCATTCAATGGATGGGGCGGTGTGCCCACTGGAAGAGCTGTGTGATGTGGC

Ensembl | Número de adesão de ser humano

ENSG00000023330

nº de adesão NCBI

NM_000688

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ALAS1(211) , ALAS1(211)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yalei Zhao et al.
Saudi journal of gastroenterology : official journal of the Saudi Gastroenterology Association, 26(3), 144-152 (2020-04-10)
Colorectal cancer (CRC) is the third most common malignant tumour worldwide and the second leading cause of cancer-related deaths. Commonly, 5'-aminolevulinic acid synthase1 (ALAS1) is the rate-limiting enzyme for haem biosynthesis. Recent studies have shown that ALAS1 is involved in
Taka-Aki Takeda et al.
Biochimica et biophysica acta, 1861(7), 1813-1824 (2017-03-30)
The degradation of heme significantly contributes to cytoprotective effects against oxidative stress and inflammation. The enzyme heme oxygenase-1 (HO-1), involved in the degradation of heme, forms carbon monoxide (CO), ferrous iron, and bilirubin in conjunction with biliverdin reductase, and is

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica