Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU150721

Sigma-Aldrich

MISSION® esiRNA

targeting human RUVBL1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGGGGATGTGCACAAAAAGAAAGAAATCATCCAAGATGTGACCTTGCATGACTTGGATGTGGCTAATGCGCGGCCCCAGGGGGGACAAGATATCCTGTCCATGATGGGCCAGCTAATGAAGCCAAAGAAGACAGAAATCACAGACAAACTTCGAGGGGAGATTAATAAGGTGGTGAACAAGTACATCGACCAGGGCATTGCTGAGCTGGTCCCGGGTGTGCTGTTTGTTGATGAGGTCCACATGCTGGACATTGAGTGCTTCACCTACCTGCACCGCGCCCTGGAGTCTTCTATCGCTCCCATCGTCATCTTTGCATCCAACCGAGGCAACTGTGTCATCAGAGGCACTGAGGACATCACATCCCCTCACGGCATCCCTCTTGACCTTCTGGACCGAGTGATG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

O Breig et al.
Leukemia, 28(6), 1271-1279 (2013-12-18)
The oncogenic fusion protein AML1-ETO, also known as RUNX1-RUNX1T1 is generated by the t(8;21)(q22;q22) translocation, one of the most frequent chromosomal rearrangements in acute myeloid leukemia (AML). Identifying the genes that cooperate with or are required for the oncogenic activity
Fabian Zimmermann et al.
Science advances, 6(51) (2020-12-24)
The microtubule nucleator γ-tubulin ring complex (γTuRC) is essential for the function of microtubule organizing centers such as the centrosome. Since its discovery over two decades ago, γTuRC has evaded in vitro reconstitution and thus detailed structure-function studies. Here, we
M Jane Morwitzer et al.
Viruses, 11(4) (2019-04-26)
Ebola virus (EBOV) is a filovirus that has become a global public health threat in recent years. EBOV is the causative agent of a severe, often fatal hemorrhagic fever. A productive viral infection relies on the successful recruitment of host

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica