Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU134001

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF7L2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TACCACAGCAAGGTCAACCAGTGTACCCAATCACGACAGGAGGATTCAGACACCCCTACCCCACAGCTCTGACCGTCAATGCTTCCATGTCCAGGTTCCCTCCCCATATGGTCCCACCACATCATACGCTACACACGACGGGCATTCCGCATCCGGCCATAGTCACACCAACAGTCAAACAGGAATCGTCCCAGAGTGATGTCGGCTCACTCCATAGTTCAAAGCATCAGGACTCCAAAAAGGAAGAAGAAAAGAAGAAGCCCCACATAAAGAAACCTCTTAATGCATTCATGTTGTATATGAAGGAAATGAGAGCAAAGGTCGTAGCTGAGTGCACGTTGAAAGAAAGCGCGGCCATCAACCAGATCCTTGGGCGGAGGTGGCATGCACTGTCCAGAGAAGAGCA

Ensembl | Número de adesão de ser humano

ENSG00000148737

nº de adesão NCBI

NM_001146274

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TCF7L2(6934) , TCF7L2(6934)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jia Cui et al.
Aging, 12(2), 1591-1609 (2020-01-24)
Islet β cell mass reduction induced by glucose fluctuation is crucial for the development and progression of T2DM. Chikusetsu saponin IVa (CHS) had protective effects against DM and related injuries. Here we aimed to investigate the role of CHS in
J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Chong Chen et al.
Cancer research, 75(8), 1725-1735 (2015-03-07)
Considerable evidence suggests that proinflammatory pathways drive self-renewal of cancer stem-like cells (CSC), but the underlying mechanisms remain mainly undefined. Here we report that the let7 repressor LIN28B and its regulator IKBKB (IKKβ) sustain cancer cell stemness by interacting with

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica