Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU133931

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPC

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAATGGCGAGGATGACTCTTAAGCACATAGTGGGGTTTAGAAATCTTATCCCATTATTTCTTTACCTAGGCGCTTGTCTAAGATCAAATTTTTCACCAGATCCTCTCCCCTAGTATCTTCAGCACATGCTCACTGTTCTCCCCATCCTTGTCCTTCCCATGTTCATTAATTCATATTGCCCCGCGCCTAGTCCCATTTTCACTTCCTTTGACGCTCCTAGTAGTTTTGTTAAGTCTTACCCTGTAATTTTTGCTTTTAATTTTGATACCTCTTTATGACTTAACAATAAAAAGGATGTATGGTTTTTATCAACTGTCTCCAAAATAATCTCTTGTTATGCAGGGAGTACAGTTCTTTTCATTCATACATAAGTTCAGTAGTTGCTTCCCTAACTGCAAAGGCAATC

Ensembl | Número de adesão de ser humano

ENSG00000092199

nº de adesão NCBI

NM_001077442

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HNRNPC(3183) , HNRNPC(3183)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

N Balaguer et al.
Molecular human reproduction, 24(8), 411-425 (2018-05-31)
Is there a specific mechanism to load the microRNA (miRNA), hsa-miR-30d, into exosomes to facilitate maternal communication with preimplantation embryos? The heterogeneous nuclear ribonucleoprotein C1 (hnRNPC1) is involved in the internalization of endometrial miR-30d into exosomes to prepare for its
Qi Chen et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 28(11), 2503-2518 (2020-07-19)
Dendritic cells (DCs) can orchestrate either immunogenic or tolerogenic responses to relay information on the functional state. Emerging studies indicate that circular RNAs (circRNAs) are involved in immunity; however, it remains unclear whether they govern DC development and function at
Zuzana Cieniková et al.
RNA (New York, N.Y.), 21(11), 1931-1942 (2015-09-16)
The human hnRNP C is a ubiquitous cellular protein involved in mRNA maturation. Recently, we have shown that this protein specifically recognizes uridine (U) pentamers through its single RNA recognition motif (RRM). However, a large fraction of natural RNA targets
Na Li et al.
Nature cell biology, 16(11), 1080-1091 (2014-10-27)
Cyclin C was cloned as a growth-promoting G1 cyclin, and was also shown to regulate gene transcription. Here we report that in vivo cyclin C acts as a haploinsufficient tumour suppressor, by controlling Notch1 oncogene levels. Cyclin C activates an

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica