Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU129311

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM10

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGAACTCTGCCATTTCACTCTGTCATTTATCATGAAGATGATATTAACTATCCCCATAAATACGGTCCTCAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGAATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGATACCTCAAGAAGAACATGCTGCTAATGGTCCAGAACTTCTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATTTGTTCTTTAAATATTACGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATTGATACAATTTACCAGACCACAGACTTCTCCGGAATCCGTAACATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTGCTGATGAGAAGGACCCTACAAATCCTTTCCGTTTCCC

Ensembl | Número de adesão de ser humano

ENSG00000137845

nº de adesão NCBI

NM_001110

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ADAM10(102) , ADAM10(102)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chuanjin Ding et al.
Oncology reports, 38(2), 866-874 (2017-06-29)
The aim of this study was to determine the effect of A disintegrin and metalloprotease 10 (ADAM10) protein expression on the progression, migration and prognosis of hypopharyngeal squamous cell carcinoma (HSCC). Immunohistochemistry and western blot analysis were performed to detect ADAM10
Zikang Xie et al.
Environmental toxicology, 35(8), 867-878 (2020-03-22)
MiR-20a has been reported as a key regulator to pro-inflammatory factor release in fibroblast-like synoviocytes (FLS), which caused rheumatoid arthritis (RA). However, the molecular mechanism of miR-20a in RA remains to be further elucidated. This study aimed to investigate the
Jessica Pruessmeyer et al.
Blood, 123(26), 4077-4088 (2014-05-17)
Inflammation is a key process in various diseases, characterized by leukocyte recruitment to the inflammatory site. This study investigates the role of a disintegrin and a metalloproteinase (ADAM) 10 and ADAM17 for leukocyte migration in vitro and in a murine
Jun Lu et al.
Cancer management and research, 12, 9577-9587 (2020-10-17)
Non-small cell lung cancer (NSCLC) remains the most commonly diagnosed malignancy and the leading cause of cancer death worldwide. Circular RNAs (circRNAs) have been demonstrated to play critical roles in human carcinogenesis, including NSCLC. However, it is still unclear whether
Xiufen Liu et al.
Communications biology, 3(1), 728-728 (2020-12-03)
Mesothelin (MSLN) is a lineage restricted cell surface protein expressed in about 30% of human cancers and high MSLN expression is associated with poor survival in several different cancers. The restricted expression of MSLN in normal tissue and its frequent
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica