Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU112941

Sigma-Aldrich

MISSION® esiRNA

targeting human ATRX

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAAGGAAGAAGTGGGCTGAAGAATTTAATGATGAAACTAATGTGAGAGGACGATTATTTATCATTTCTACTAAAGCAGGATCTCTAGGAATTAATCTGGTAGCTGCTAATCGAGTAATTATATTCGACGCTTCTTGGAATCCATCTTATGACATCCAGAGTATATTCAGAGTTTATCGCTTTGGACAAACTAAGCCTGTTTATGTATATAGGTTCTTAGCTCAGGGAACCATGGAAGATAAGATTTATGATCGGCAAGTAACTAAGCAGTCACTGTCTTTTCGAGTTGTTGATCAGCAGCAGGTGGAGCGTCATTTTACTATGAATGAGCTTACTGAACTTTATACTTTTGAGCCAGACTTATTAGATGACCCTAATTCAGAAAAGAAGAAGAAGAGGGATACTCCCATGCTGCCAAAG

Ensembl | Número de adesão de ser humano

ENSG00000085224

nº de adesão NCBI

NM_138270

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ATRX(546) , ATRX(546)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jaewon Min et al.
Nucleic acids research, 45(5), 2615-2628 (2017-01-14)
Alternative lengthening of telomeres (ALT) is a telomerase independent telomere maintenance mechanism that occurs in ∼15% of cancers. The potential mechanism of ALT is homology-directed telomere synthesis, but molecular mechanisms of how ALT maintains telomere length in human cancer is
Manav Pathania et al.
Cancer cell, 32(5), 684-700 (2017-11-07)
Gain-of-function mutations in histone 3 (H3) variants are found in a substantial proportion of pediatric high-grade gliomas (pHGG), often in association with TP53 loss and platelet-derived growth factor receptor alpha (PDGFRA) amplification. Here, we describe a somatic mouse model wherein
Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Jinquan Cai et al.
Oncotarget, 6(20), 18105-18115 (2015-05-15)
Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica