Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU106231

Sigma-Aldrich

MISSION® esiRNA

targeting human PGD

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em21 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em21 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGTTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAATACGGCGTACCCGTCACCCTCATTGGAGAAGCTGTCTTTGCTCGGTGCTTATCATCTCTGAAGGATGAGAGAATTCAAGCTAGCAAAAAGCTGAAGGGTCCCCAGAAGTTCCAGTTTGATGGTGATAAGAAATCATTCCTGGAGGACATTCGGAAGGCACTCTACGCTTCCAAGATCATCTCTTACGCTCAAGGCTTTATGCTGCTAAGGCAGGCAGCCACCGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCATCATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACC

Ensembl | Número de adesão de ser humano

ENSG00000142657

nº de adesão NCBI

NM_002631

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PGD(5226) , PGD(5226)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BBV
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jun Cao et al.
The American journal of the medical sciences, 360(3), 279-286 (2020-08-25)
The essential role of 6-phosphogluconate dehydrogenase (6PGD), the enzyme catalyzing the oxidative pentose phosphate pathway, in tumor growth and metabolism has garnered attention in recent years. In this work, we are the first to demonstrate that aberrant activation of 6PGD
Xiaoyu Yang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 20(9), 1145-1152 (2018-01-18)
6-phosphogluconate dehydrogenase (6PGD), a key enzyme of the oxidative pentose phosphate pathway, is involved in tumor growth and metabolism. Although high 6PGD activity has been shown to be associated with poor prognosis, its role and therapeutic value in breast cancer
Wujian Zheng et al.
Frontiers in pharmacology, 8, 421-421 (2017-07-18)
Cisplatin (DDP) is currently one of the most commonly used chemotherapeutic drugs for treating ovarian and lung cancer. However, resistance to cisplatin is common and it often leads to therapy failure. In addition, the precise mechanism of cisplatin resistance is

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica