Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU100561

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC7A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCACCCAGCCTAGAATCTTGTATAATATGTAATTGTAGGGAAACTGCTCTCATAGGAAAGTTTTCTGCTTTTTAAATACAAAAATACATAAAAATACATAAAATCTGATGATGAATATAAAAAAGTAACCAACCTCATTGGAACAAGTATTAACATTTTGGAATATGTTTTATTAGTTTTGTGATGTACTGTTTTACAATTTTTACCATTTTTTTCAGTAATTACTGTAAAATGGTATTATTGGAATGAAACTATATTTCCTCATGTGCTGATTTGTCTTATTTTTTTCATACTTTCCCACTGGTGC

Ensembl | Número de adesão de ser humano

ENSG00000172243

nº de adesão NCBI

NM_022570

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CLEC7A(64581) , CLEC7A(64581)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cheng-Ye Che et al.
International journal of ophthalmology, 11(6), 905-909 (2018-07-07)
To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of
Esther Weiss et al.
Frontiers in cellular and infection microbiology, 8, 288-288 (2018-09-05)
Invasive aspergillosis (IA) is an infectious disease caused by the fungal pathogen Aspergillus fumigatus that mainly affects immunocompromised hosts. To investigate immune cell cross-talk during infection with A. fumigatus, we co-cultured natural killer (NK) cells and dendritic cells (DC) after
Nobuaki Fujiwara et al.
Cancer gene therapy, 26(1-2), 32-40 (2018-07-05)
Antisense oligonucleotides (AS-ODNs) hybridize with specific mRNAs, resulting in interference with the splicing mechanism or the regulation of protein translation. We previously demonstrated that the β-glucan schizophyllan (SPG) can form a complex with AS-ODNs with attached dA40 (AS-ODNs/SPG), and this
Kelan Yuan et al.
International immunopharmacology, 52, 168-175 (2017-09-20)
To investigate the role of phosphorylated JNK in Dectin-1-induced IL-1β production and the role of Dectin-1 in apoptosis in mouse Aspergillus fumigatus (A. fumigatus) keratitis. Mice corneas were pretreated with Dectin-1 siRNA or SP600125 (the inhibitor of JNK) before A.
Xia Hua et al.
PloS one, 10(6), e0128039-e0128039 (2015-06-04)
Fungal infections of the cornea can be sight-threatening and have a worse prognosis than other types of microbial corneal infections. Peptidoglycan recognition proteins (PGLYRP), which are expressed on the ocular surface, play an important role in the immune response against
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica