Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU077661

Sigma-Aldrich

MISSION® esiRNA

targeting human SPP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAAAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAAGAAAAAATGCTTTATAGCAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTGTATCTATTTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAACTCC

Ensembl | Número de adesão de ser humano

ENSG00000118785

nº de adesão NCBI

NM_000582

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SPP1(6696) , SPP1(6696)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yao Fan et al.
Bone research, 8, 9-9 (2020-03-05)
Osteocytes are mechanosensitive bone cells, but little is known about their effects on tumor cells in response to mechanical stimulation. We treated breast cancer cells with osteocyte-derived conditioned medium (CM) and fluid flow-treated conditioned medium (FFCM) with 0.25 Pa and 1 Pa
Beibei Zhang et al.
Experimental and therapeutic medicine, 20(4), 3633-3642 (2020-08-29)
The metastatic behavior of hepatocellular carcinoma (HCC) is one of the key factors that leads to poor prognosis. The aim of the current study was to determine the changes in metastasis and the proliferation potential of bone marrow mesenchymal stem
Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Huan Yu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(3), e21405-e21405 (2021-02-10)
Microglia activation and release of pro-inflammatory cytokines have been closely linked to glaucoma. However, the mechanisms that initiate these pathways remain unclear. Here, we investigated the role of a pro-inflammatory cytokine--osteopontin (OPN), in retinal microglia activation process along with the
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica