Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU074901

Sigma-Aldrich

MISSION® esiRNA

targeting human CBLB

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTCTCCAAAACCTGGAATCACAGCGAGTTCAAATGTCAATGGAAGGCACAGTAGAGTGGGCTCTGACCCAGTGCTTATGCGGAAACACAGACGCCATGATTTGCCTTTAGAAGGAGCTAAGGTCTTTTCCAATGGTCACCTTGGAAGTGAAGAATATGATGTTCCTCCCCGGCTTTCTCCTCCTCCTCCAGTTACCACCCTCCTCCCTAGCATAAAGTGTACTGGTCCGTTAGCAAATTCTCTTTCAGAGAAAACAAGAGACCCAGTAGAGGAAGATGATGATGAATACAAGATTCCTTCATCCCACCCTGTTTCCCTGAATTCACAACCATCTCATTGTCATAATGTAAAACCTCCTGTTCGGTCTTGTGATAATGGTCACTGTATGCTGAATGGAACACATGGT

Ensembl | Número de adesão de ser humano

ENSG00000114423

nº de adesão NCBI

NM_170662

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CBLB(868) , CBLB(868)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Juan Tang et al.
The Journal of experimental medicine, 217(4) (2020-01-31)
Aberrant NLRP3 inflammasome activation contributes to the development of endotoxemia. The importance of negative regulation of NLRP3 inflammasomes remains poorly understood. Here, we show that the E3 ubiquitin ligase Cbl-b is essential for preventing endotoxemia induced by a sub-lethal dose
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica