Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU060131

Sigma-Aldrich

MISSION® esiRNA

targeting human IL17RB

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGATGCCACTGCTTTCTGTGCAGAACTTCTCCATGTCAAGCAGCAGGTGTCAGCAGGAAAAAGATCACAAGCCTGCCACGATGGCTGCTGCTCCTTGTAGCCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGCTTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTAGCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAAAACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAG

Ensembl | Número de adesão de ser humano

ENSG00000056736

nº de adesão NCBI

NM_018725

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IL17RB(55540) , IL17RB(55540)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yong-Sheng Teng et al.
Cell death & disease, 10(2), 79-79 (2019-01-30)
Interleukin-17 receptor B (IL-17RB), a member of the IL-17 receptor family activated by IL-17B/IL-17E, has been shown to be involved in inflammatory diseases. However, the regulation and function of IL-17RB in Helicobacter pylori (H. pylori) infection, especially in the early-phase
Suxun Pan et al.
Cell biology international, 44(11), 2220-2230 (2020-07-28)
Interleukin-25 (IL-25) has been recognized as a new member of the IL-17 family and implicated in various inflammatory pathology. We aimed to investigate the effects of IL-25 on the expression of matrix metalloproteinase-2 (MMP-2), MMP-8, and MMP-9 in periodontal fibroblast
Lei Ren et al.
Molecular immunology, 90, 126-135 (2017-07-18)
IL-17RB, a member of the IL-17 receptor family that can be activated by IL-17B, has been proved to be involved in inflammatory diseases and cancers. However, the function of IL-17RB in thyroid cancer is still unknown. In this study, IL-17RB

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica