Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU048911

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFSF13B

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGTTCAGGGTCCAGAAGAAACAGTCACTCAAGACTGCTTGCAACTGATTGCAGACAGTGAAACACCAACTATACAAAAAGGATCTTACACATTTGTTCCATGGCTTCTCAGCTTTAAAAGGGGAAGTGCCCTAGAAGAAAAAGAGAATAAAATATTGGTCAAAGAAACTGGTTACTTTTTTATATATGGTCAGGTTTTATATACTGATAAGACCTACGCCATGGGACATCTAATTCAGAGGAAGAAGGTCCATGTCTTTGGGGATGAATTGAGTCTGGTGACTTTGTTTCGATGTATTCAAAATATGCCTGAAACACTACCCAATAATTCCTGCTATTCAGCTGGCATTGCAAAACTGGAAGAAGGAGATGAACTCCAACTTGCAATACCAAGAGAAAATGCACAAATATCACTGGATGGAGATGTCACATTTTTTGGTGCATTGAAACTGCTGT

Ensembl | Número de adesão de ser humano

ENSG00000102524

nº de adesão NCBI

NM_006573

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TNFSF13B(10673) , TNFSF13B(10673)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaofang Tang et al.
Life sciences, 241, 117172-117172 (2019-12-18)
Allergic airway inflammation is one of the major pathological events involved in asthma, and dysregulation of regulatory T cells (Treg) plays a crucial role in the development of allergic airway inflammation. Here, we attempted to investigate the regulatory effects of
Hiroki Kobayashi et al.
Oncotarget, 6(34), 36615-36624 (2015-10-17)
Denticleless E3 ubiquitin protein ligase homolog (DTL) has been identified in amplified region (1q32) of several cancers and has an oncogenic function. In this study, we tested whether DTL acts as a cancer-promoting gene through its activation/overexpression in gastric cancer

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica