Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Ensembl | Número de adesão de ser humano

ENSG00000121966

nº de adesão NCBI

NM_001008540

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CXCR4(7852) , CXCR4(7852)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Markus Eberl et al.
EMBO molecular medicine, 4(3), 218-233 (2012-02-02)
Inhibition of Hedgehog (HH)/GLI signalling in cancer is a promising therapeutic approach. Interactions between HH/GLI and other oncogenic pathways affect the strength and tumourigenicity of HH/GLI. Cooperation of HH/GLI with epidermal growth factor receptor (EGFR) signalling promotes transformation and cancer
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Ying Wang et al.
Frontiers in oncology, 9, 1487-1487 (2020-02-13)
Purpose: Due to a lack of recognized molecular targets for therapy, patients with triple-negative breast cancer (TNBC), unlike other subtypes of breast cancers, generally have not benefited from the advances made with targeted agents. The CXCR4/SDF-1 axis is involved in
Nahyeon Kang et al.
BMC cancer, 19(1), 148-148 (2019-02-15)
A hypoxic microenvironment leads to an increase in the invasiveness and the metastatic potential of cancer cells within tumors via the epithelial-mesenchymal transition (EMT) and cancer stemness acquisition. However, hypoxia-induced changes in the expression and function of candidate stem cell
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica