Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU012281

Sigma-Aldrich

MISSION® esiRNA

targeting human CLEC14A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCTGGGACAAACTCTCGGGCGATGTGTTGTGTCCCTGCCCCGGGAGGTACCTCCGTGCTGGCAAATGCGCAGAGCTCCCTAACTGCCTAGACGACTTGGGAGGCTTTGCCTGCGAATGTGCTACGGGCTTCGAGCTGGGGAAGGACGGCCGCTCTTGTGTGACCAGTGGGGAAGGACAGCCGACCCTTGGGGGGACCGGGGTGCCCACCAGGCGCCCGCCGGCCACTGCAACCAGCCCCGTGCCGCAGAGAACATGGCCAATCAGGGTCGACGAGAAGCTGGGAGAGACACCACTTGTCCCTGAACAAGACAATTCAGTAACATCTATTCCTGAGATTCCTCGATGGGGATCACAGAGCACGATGTCTACCCTTCAAATGTCCCTTCAAGCCGAGTCAAAGGCCACTATCACCCCATCAGGGAGCGTGATTTCCAAGTTTAATTCTACGACTTCCTCTGCCACTCCTCA

Ensembl | Número de adesão de ser humano

ENSG00000176435

nº de adesão NCBI

NM_175060

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CLEC14A(161198) , CLEC14A(161198)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yeomyeong Kim et al.
Journal of neuroinflammation, 17(1), 48-48 (2020-02-06)
Ischemic stroke is a main cause of mortality. Blood-brain barrier (BBB) breakdown appears to play a critical role in inflammation in patients with ischemic stroke and acceleration of brain injury. The BBB has a protective function and is composed of
Sungwoon Lee et al.
The Journal of clinical investigation, 127(2), 457-471 (2016-12-20)
Controlled angiogenesis and lymphangiogenesis are essential for tissue development, function, and repair. However, aberrant neovascularization is an essential pathogenic mechanism in many human diseases, including diseases involving tumor growth and survival. Here, we have demonstrated that mice deficient in C-type
P J Noy et al.
Oncogene, 34(47), 5821-5831 (2015-03-10)
We previously identified CLEC14A as a tumour endothelial marker. Here we show that CLEC14A is a regulator of sprouting angiogenesis in vitro and in vivo. Using a human umbilical vein endothelial cell spheroid-sprouting assay, we found CLEC14A to be a

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica