Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU006671

Sigma-Aldrich

MISSION® esiRNA

targeting human RNMT

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTGACATGATGCTGAGAAATGCGTGTGAGAGACTTAGCCCTGGGGGCTATTTTATTGGTACTACTCCCAATAGCTTTGAATTGATAAGACGCCTTGAAGCTTCAGAAACAGAATCATTTGGAAATGAAATATATACTGTGAAATTTCAGAAGAAAGGAGATTATCCTTTATTTGGCTGCAAATATGACTTCAACTTGGAAGGTGTTGTGGATGTTCCTGAATTCTTGGTCTATTTTCCATTGCTAAATGAAATGGCAAAGAAGTACAATATGAAACTAGTCTACAAAAAAACATTTCTGGAATTCTACGAAGAAAAGATTAAGAACAATGAAAATAAAATGCTCTTAAAACGAATGCAGGCCTTGGAGCCATATCCTGCAAATGAGAGTTCTAAACTTGTCTCTGAGAAGGTGGATGACTATGAACATGCAGCAAAGTACATGAAGAACAGTCAAGTAAGGTTACCTTTGGGAACCTTAAGTAAATCAGAATGGGAAGCTACAAGTATTTACTTGGTGTTTGCCTTTGAGAAACAGCA

Ensembl | Número de adesão de ser humano

ENSG00000101654

nº de adesão NCBI

NM_003799

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RNMT(8731) , RNMT(8731)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jun Liu et al.
Journal of experimental & clinical cancer research : CR, 34, 35-35 (2015-05-01)
Gastric cancer (GC) remains one of the most common types of malignant cancer, and the molecular mechanism underlying its metastasis is still largely unclear. MicroRNAs have emerged as important regulators of metastasis because of their ability to act on multiple
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Hanyin Cheng et al.
Cancer research, 75(13), 2737-2748 (2015-05-09)
Uveal melanoma patients with metastatic disease usually die within one year, emphasizing an urgent need to develop new treatment strategies for this cancer. MEK inhibitors improve survival in cutaneous melanoma patients but show only modest efficacy in metastatic uveal melanoma
Katarzyna Miekus et al.
Oncotarget, 6(12), 10086-10101 (2015-04-19)
Cervical cancer is one of the leading causes of death among women suffering from tumors. Current treatment options are insufficient. Here, we investigated the MET receptor as a potential molecular target in advanced cervical cancer. Downregulation of MET receptor expression
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica