Skip to Content
Merck
All Photos(1)

Key Documents

EHU038621

Sigma-Aldrich

MISSION® esiRNA

targeting human B2M

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCATCCATCCGACATTGAAGTTGACTTACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCCCACTGAAAAAGATGAGTATGCCTGCCGTGTGAACCATGTGACTTTGTCACAGCCCAAGATAGTTAAGTGGGATCGAGACATGTAAGCAGCATCATGGAGGTTTGAAGATGCCGCATTTGGATTGGATGAATTCCAAATTCTGCTTGCTTGCTTTTTAATATTGATATGCTTATACACTTACACTTTATGCACAAAATGTAGGGTTATAATAATGTTAACATGGACATGATCTTCTTTATAATTCTACTTTGAGTGCTGTCTCCATGTTTGATGTATCTGAGCAGGTTGCTCCACAGGTAGCTCTAGGAGGGCTGGCAACTTAGAGGTGGGGAGCAGAGA

Ensembl | human accession no.

ENSG00000166710

NCBI accession no.

NM_004048

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... B2M(567) , B2M(567)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Egle-Helene Ervin et al.
Stem cell research & therapy, 10(1), 43-43 (2019-01-27)
Human embryonic stem (hES) cells serve as an invaluable tool for research and future medicine, but their transfection often leads to unwanted side effects as the method itself may induce differentiation. On the other hand, RNA interference (RNAi)-based targeted gene
Matthew E Agwae et al.
Molecular biology reports, 47(5), 3987-3992 (2020-04-03)
iRhom2 is an inactive rhomboid protease involved in diverse signalling events. It has been implicated in the pathogenesis of a number of cancer types, including oesophageal and ovarian cancer, while its closely associated family member, iRhom1, is implicated in head
Zaruhi Karabekian et al.
Biomedical materials (Bristol, England), 10(3), 034101-034101 (2015-03-17)
The presence of non-autologous major histocompatibility complex class I (MHC-I) molecules on the surface of the grafted cells is one of the main reasons for their rejection in non-syngeneic hosts. We present a straightforward strategy to decrease the presence of
Marlieke L M Jongsma et al.
Immunity, 54(1), 132-150 (2020-12-04)
HLA class I (HLA-I) glycoproteins drive immune responses by presenting antigens to cognate CD8+ T cells. This process is often hijacked by tumors and pathogens for immune evasion. Because options for restoring HLA-I antigen presentation are limited, we aimed to identify

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service