Skip to Content
Merck
All Photos(1)

Key Documents

EHU114901

Sigma-Aldrich

MISSION® esiRNA

targeting human ATF4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAACAACAGCAAGGAGGATGCCTTCTCCGGGACAGATTGGATGTTGGAGAAAATGGATTTGAAGGAGTTCGACTTGGATGCCCTGTTGGGTATAGATGACCTGGAAACCATGCCAGATGACCTTCTGACCACGTTGGATGACACTTGTGATCTCTTTGCCCCCCTAGTCCAGGAGACTAATAAGCAGCCCCCCCAGACGGTGAACCCAATTGGCCATCTCCCAGAAAGTTTAACAAAACCCGACCAGGTTGCCCCCTTCACCTTCTTACAACCTCTTCCCCTTTCCCCAGGGGTCCTGTCCTCCACTCCAGATCATTCCTTTAGTTTAGAGCTGGGCAGTGAAGTGGATATCACTGAAGGAGATAGGAAGCCAGACTACACTGCTTACGTTGCCATGATCCCT

Ensembl | human accession no.

ENSG00000128272

NCBI accession no.

NM_001675

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ATF4(468) , ATF4(468)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoko Tabe et al.
Scientific reports, 8(1), 16837-16837 (2018-11-18)
Adipocytes are the prevalent stromal cell type in adult bone marrow (BM), and leukemia cells continuously adapt to deficiency of nutrients acquiring chemoresistant profiles in the BM microenvironment. We have previously shown that fatty acid metabolism is a key energy
Zhen Ren et al.
Toxicological sciences : an official journal of the Society of Toxicology, 154(2), 368-380 (2016-09-11)
Nefazodone, an antagonist for the 5-hydroxytryptanine receptor, has been used for the treatment of depression. Acute liver injury has been documented to be associated with the use of nefazodone; however, the mechanisms of nefazodone-induced liver toxicity are not well defined.
Hao Chen et al.
Oncology research, 27(3), 325-334 (2018-05-03)
It is well known that activating transcription factor 4 (ATF4) expression is closely associated with progression of many cancers. We found that miR-1283 could directly target ATF4. However, the precise mechanisms of miR-1283 in glioma have not been well clarified.
Ritesh K Srivastava et al.
Toxicology and applied pharmacology, 308, 46-58 (2016-07-28)
Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here
Hui Zhang et al.
Journal of translational medicine, 13, 178-178 (2015-06-05)
Anti-dsDNA antibodies play an important role in the pathogenesis of lupus nephritis (LN). Endoplasmic reticulum (ER) stress is a physical reaction under stressful condition and can cause inflammation when stimulation is sustained. This study investigated the roles of ER stress
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service