Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU090501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nsg1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGTGTCACCGAGAGGTTTAAGGTCTCCGTGCTGGTCCTCTTTGCCCTGGCCTTCCTCACCTGTGTCGTCTTCCTGGTTGTCTACAAAGTGTACAAGTATGACCGCGCCTGCCCTGATGGGTTTGTCTTGAAGAACACCCAGTGCATCCCAGAAGGCTTGGAGAGCTACTACACGGAGCAAGACTCCAGTGCCCGGGAGAAATTTTACACTGTCATAAACCACTACAACGTGGCCAAGCAGAGCATCACCCGCTCCGTGTCGCCATGGATGTCAGTTCTGTCAGAAGAGAAGCTGTCGGAACAGGAGACCGAAGCTGCAGAGAAGTCAGCTTAGCGAGCAGGGCAGGTTCCTTACGATGTGTCACTTGAAGGCAACAAGGGGACTTTGAGGGACATTTCATTAAATATAATTACCGATAATTTAGAGATTACTCATTTACGGTGCAATTGCTTCTGTTTGCTAATGCTGCTTTGCAAATTAAACTTGCTGCGGACCACCCACAGGCGTAAGAACAAGAGCATCTCAGCATTGCTTAGAGAGCTGGATGCCACTGTCCACGCTGAGGAGTCTTC

Numéro d'accès Ensembl | souris

ENSMUSG00000029126

Numéro d'accès NCBI

NM_010942

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NSG1(18196) , Nsg1(18196)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Purusottam Mohapatra et al.
The international journal of biochemistry & cell biology, 66, 75-84 (2015-07-28)
Combination therapy using two or more small molecule inhibitors of aberrant signaling cascade in aggressive breast cancers is a promising therapeutic strategy over traditional monotherapeutic approaches. Here, we have studied the synergistic mechanism of resveratrol and curcumin induced apoptosis using
Daqian Wan et al.
Anti-cancer drugs, 26(9), 931-941 (2015-07-17)
Aspidin PB is a natural product extracted from Dryopteris fragrans (L.) Schott, which has been characterized for its various biological activities. We reported that aspidin PB induced cell cycle arrest and apoptosis through the p53/p21 and mitochondria-dependent pathways in human
Koichi Shoji et al.
Oncology reports, 32(1), 65-70 (2014-05-21)
Fibroblast growth factor receptor 2 (FGFR2) is thought to mediate an important signaling pathway between prostate epithelial cells and stromal cells for maintenance of homeostasis in normal prostate tissue. Abnormalities of FGFR2 have been shown in advanced prostate cancer or
Haizhi Huang et al.
Journal of functional foods, 15, 464-475 (2015-06-27)
Galangin and myricetin are flavonoids isolated from vegetables and fruits which exhibit anti-proliferative activity in human cancer cells. In this study, their anti-angiogenic effects were investigated with
Malte Kriegs et al.
Radiotherapy and oncology : journal of the European Society for Therapeutic Radiology and Oncology, 115(1), 120-127 (2015-03-23)
How EGF receptor (EGFR) inhibition induces cellular radiosensitization and with that increase in tumor control is still a matter of discussion. Since EGFR predominantly regulates cell cycle and proliferation, we studied whether a G1-arrest caused by EGFR inhibition may contribute
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique