Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU161041

Sigma-Aldrich

MISSION® esiRNA

targeting human GPBAR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
192,00 €
50 μG
341,00 €

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.
Toutes les photos(1)

Sélectionner une taille de conditionnement

Changer de vue
20 μG
192,00 €
50 μG
341,00 €

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

192,00 €

Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGGGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCGTCCAGCTCAGCCATCCAGCCTGTCTCTACC

Numéro d'accès Ensembl | humain

ENSG00000179921

Numéro d'accès NCBI

NM_001077191

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GPBAR1(151306) , GPBAR1(151306)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui Liang et al.
Journal of neuroinflammation, 18(1), 40-40 (2021-02-04)
Nucleotide-binding oligomerization domain-like receptor pyrin domain-containing protein 3 (NLRP3) plays an important role in mediating inflammatory responses during ischemic stroke. Bile acid receptor Takeda-G-protein-receptor-5 (TGR5) has been identified as an important component in regulating brain inflammatory responses. In this study
Ai-Di Li et al.
Experimental cell research, 389(2), 111855-111855 (2020-01-25)
Takeda-G-protein-receptor-5 (TGR5) is a G-protein-coupled receptor (GPCR) activated by bile acids, and mortalin is a multipotent chaperone of the HSP70 family. In the present study, TGR5 was detected by immunohistochemistry (IHC) in extrahepatic cholangiocarcinoma (ECC) specimens, and TGR5 expression in
You-Chao Qi et al.
Chinese journal of natural medicines, 18(12), 898-906 (2020-12-29)
Taurochenodeoxycholic acid (TCDCA) is one of the main effective components of bile acid, playing critical roles in apoptosis and immune responses through the TGR5 receptor. In this study, we reveal the interaction between TCDCA and TGR5 receptor in TGR5-knockdown H1299
Yu Chen et al.
International immunopharmacology, 71, 144-154 (2019-03-23)
NLRP3 inflammasome has been reported to be associated with inflammatory bowel disease including colitis due to its potential ability to induce IL-1β secretion. Emerging studies have demonstrated that Genistein, a major isoflavone, has potential anti-inflammatory effects in murine model colitis.
Haiming Xiao et al.
Pharmacological research, 151, 104559-104559 (2019-11-24)
Our previous studies indicated that the G-protein-coupled bile acid receptor, Gpbar1 (TGR5), inhibits inflammation by inhibiting the NF-κB signalling pathway, eventually attenuating diabetic nephropathy (DN). Gentiopicroside (GPS), the main active secoiridoid glycoside of Gentiana manshurica Kitagawa, has been demonstrated to
Afficher tous les articles scientifiques apparentés

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique