Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU158661

Sigma-Aldrich

MISSION® esiRNA

targeting human NONO

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTG

Numéro d'accès Ensembl | humain

ENSG00000147140

Numéro d'accès NCBI

NM_001145408

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NONO(4841) , NONO(4841)

Catégories apparentées

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rui Cheng et al.
Oncology reports, 39(6), 2575-2583 (2018-04-06)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignancies in China, and is associated with high morbidity and mortality. However, the molecular mechanisms that control ESCC tumorigenicity and metastasis remain unclear. Here, we report that the RNA
Taotao Han et al.
The Journal of clinical investigation, 130(7), 3901-3918 (2020-06-17)
Chronic infections can lead to carcinogenesis through inflammation-related mechanisms. Chronic infection of the human gastric mucosa with Helicobacter pylori is a well-known risk factor for gastric cancer. However, the mechanisms underlying H. pylori-induced gastric carcinogenesis are incompletely defined. We aimed
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be
Jarrod S Johnson et al.
Cell reports, 30(3), 914-931 (2020-01-23)
Transcriptional programming of the innate immune response is pivotal for host protection. However, the transcriptional mechanisms that link pathogen sensing with innate activation remain poorly understood. During HIV-1 infection, human dendritic cells (DCs) can detect the virus through an innate
Asma Chaoui et al.
Human molecular genetics, 24(17), 4933-4947 (2015-06-11)
SOX10 is a transcription factor with well-known functions in neural crest and oligodendrocyte development. Mutations in SOX10 were first associated with Waardenburg-Hirschsprung disease (WS4; deafness, pigmentation defects and intestinal aganglionosis). However, variable phenotypes that extend beyond the WS4 definition are

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique