Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU151981

Sigma-Aldrich

MISSION® esiRNA

targeting human HIF1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAAGC

Numéro d'accès Ensembl | humain

ENSG00000100644

Numéro d'accès NCBI

NM_001530

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HIF1A(3091) , HIF1A(3091)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Klaartje Somers et al.
Oncogene, 38(20), 3824-3842 (2019-01-24)
Survival rates for pediatric patients suffering from mixed lineage leukemia (MLL)-rearranged leukemia remain below 50% and more targeted, less toxic therapies are urgently needed. A screening method optimized to discover cytotoxic compounds selective for MLL-rearranged leukemia identified CCI-006 as a
Shu Lou et al.
Frontiers in cell and developmental biology, 8, 576-576 (2020-08-09)
Although genetic variants in autophagy pathway genes were associated with the risk of oral cancers and early development in embryos, their associations with non-syndromic cleft lip with or without cleft palate (NSCL/P) risk remained unclear. A two-stage case-control study (2,027
Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Matilda Munksgaard Thorén et al.
Oncotarget, 8(30), 48983-48995 (2017-04-22)
We previously demonstrated that small cell lung carcinoma (SCLC) cells lack HIF-2α protein expression, whereas HIF-1α in these cells is expressed at both acute and prolonged hypoxia. Here we show that low HIF2A expression correlates with high expression of MYC
Yong Zhang et al.
Science translational medicine, 7(290), 290ra92-290ra92 (2015-06-05)
Whereas amphibians regenerate lost appendages spontaneously, mammals generally form scars over the injury site through the process of wound repair. The MRL mouse strain is an exception among mammals because it shows a spontaneous regenerative healing trait and so can
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique