Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU106961

Sigma-Aldrich

MISSION® esiRNA

targeting human FKBP1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGATGCTTGAAGATGGAAAGAAATTTGATTCCTCCCGGGACAGAAACAAGCCCTTTAAGTTTATGCTAGGCAAGCAGGAGGTGATCCGAGGCTGGGAAGAAGGGGTTGCCCAGATGAGTGTGGGTCAGAGAGCCAAACTGACTATATCTCCAGATTATGCCTATGGTGCCACTGGGCACCCAGGCATCATCCCACCACATGCCACTCTCGTCTTCGATGTGGAGCTTCTAAAACTGGAATGACAGGAATGGCCTCCTCCCTTAGCTCCCTGTTCTTGGATCTGCCATGGAGGGATCTGGTGCCTCCAGACATGTGCACATGAATCCATATGGAGCTTTTCCTGATGTTCCACTCCACTTTGTATAGACATCTGCCCTGACTGAATGTGTTCTGTCACTCAGCTTTGCTTCCGACACCTCTGTTTC

Numéro d'accès Ensembl | humain

ENSG00000088832

Numéro d'accès NCBI

NM_000801

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FKBP1A(2280) , FKBP1A(2280)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mingyou Xing et al.
Cancer chemotherapy and pharmacology, 84(4), 861-872 (2019-08-21)
FK506-binding protein 12 (FKBP12) is abundant, ubiquitously expressed cytoplasmic protein with multiple functions in cell signaling transduction. Recently, we reported a novel function for FKBP12 in oncoprotein mouse double minute 2 (MDM2) self-ubiquitination and degradation, which greatly enhanced the sensitivity
Zicheng Wang et al.
Journal of cell science, 132(10) (2019-04-28)
Necroptosis is a regulated form of necrotic cell death that is mediated by receptor-interacting serine/threonine-protein kinase 1 (RIPK1), RIPK3 and mixed-lineage kinase domain-like protein (MLKL), which mediates necroptotic signal transduction induced by tumor necrosis factor (TNF). Although many target proteins
Itziar M D Posada et al.
Oncotarget, 8(27), 44550-44566 (2017-06-01)
Currently several combination treatments of mTor- and Ras-pathway inhibitors are being tested in cancer therapy. While multiple feedback loops render these central signaling pathways robust, they complicate drug targeting.Here, we describe a novel H-ras specific feedback, which leads to an
Tanner Stokes et al.
Cell reports, 32(5), 107980-107980 (2020-08-07)
Loading of skeletal muscle changes the tissue phenotype reflecting altered metabolic and functional demands. In humans, heterogeneous adaptation to loading complicates the identification of the underpinning molecular regulators. A within-person differential loading and analysis strategy reduces heterogeneity for changes in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique