Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU085481

Sigma-Aldrich

MISSION® esiRNA

targeting human MCRS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTCAAGGACATGCGAGATGAGGTCCTGGAACATGAGCTGATGGTGGCTGACCGGCGCCAGAAGCGAGAGATTCGGCAGCTGGAACAGGAACTGCATAAGTGGCAGGTGCTAGTGGACAGCATCACAGGCATGAGCTCTCCGGACTTCGACAACCAGACACTGGCAGTGCTGCGGGGCCGCATGGTGCGGTACCTGATGCGCTCGCGTGAGATCACCCTGGGCAGAGCAACCAAGGATAACCAGATTGATGTGGACCTGTCTCTGGAGGGTCCGGCCTGGAAGATATCCCGGAAACAAGGTGTCATCAAGCTGAAGAACAACGGTGATTTCTTCATTGCCAATGAGGGTCGACGGCCCATCTACATCGATGGACGGCCGGTGCTCTGTGGCTCCAAATGGCGCCTCAGCAACAACTCTGTGGTGGAGATCGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xin-Meng Wang et al.
Cellular signalling, 59, 171-181 (2019-04-07)
Microspherule protein 1(MCRS1) is known to be an oncogene in several tumors. However, recent studies have shown that MCRS1 inhibits lymphatic metastasis in gastric cancer (GC) patients by inhibiting telomerase activity. Protein kinase, membrane associated tyrosine/threonine 1(Pkmyt1), a member of
Marta Brandt et al.
Cell metabolism, 27(1), 118-135 (2017-12-26)
Dietary habits that can induce inflammatory bowel disease (IBD) are major colorectal cancer (CRC) risk factors, but mechanisms linking nutrients, IBD, and CRC are unknown. Using human data and mouse models, we show that mTORC1 inactivation-induced chromosomal instability impairs intestinal

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique