Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU085201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGTCGAGGCTAGAGGCATTTGGAACAACAAATCTACGTAGTTAACTTGAAGAAACCGATTTTTAAAGTTGGTGCATCTAGAAAGCTTTGAATGCAGAAGCAAACAAGCTTGATTTTTCTAGCATCCTCTTAATGTGCAGCAAAAGCAGGCGACAAAATCTCCTGGCTTTACAGACAAAAATATTTCAGCAAACGTTGGGCATCATGGTTTTTGAAGGCTTTAGTTCTGCTTTCTGCCTCTCCTCCACAGCCCCAACCTCCCACCCCTGATACATGAGCCAGTGATTATTCTTGTTCAGGGAGAAGATCATTTAGATTTGTTTTGCATTCCTTAGAATGGAGGGCAACATTCCACAGCTGCCCTGGCTGTGATGAGTGTCCTTGCAGGGGCCGGAGTAGGAGCACTGGGGTGGGGGTGGAATTGGGGTTACTCGA

Numéro d'accès Ensembl | humain

ENSG00000104419

Numéro d'accès NCBI

NM_006096

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NDRG1(10397) , NDRG1(10397)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinju Liu et al.
Human cell, 33(4), 1176-1185 (2020-08-07)
Numerous studies demonstrated that microRNAs (miRNAs) were highly involved in pancreatic cancer development. However, the functional roles of many miRNAs remain elusive in pancreatic cancer. In the present study, we analyzed previous published microarray data and found that miR-1469-5p was
Gang Cen et al.
Oncology reports, 37(2), 1189-1195 (2017-01-12)
The N-myc downstream regulated gene 1 (NDRG1) is differently expressed in human malignancies according to the tumor type. We investigated the expression of NDRG1 in pancreatic cancer tissues and cell lines as well as how it affects tumor growth, invasion and
Aiwei Li et al.
Scientific reports, 9(1), 5166-5166 (2019-03-28)
N-myc downstream regulated gene 1 (NDRG1) is an intracellular protein involved in cell differentiation and was recently reported to exert various effects in several cancers. However, its expression and role in bladder cancer remain unclear. Our study enrolled 100 bladder
Nan Meng et al.
Molecular reproduction and development, 86(9), 1210-1223 (2019-07-25)
Embryo implantation is an essential step for a successful pregnancy, and any defect in this process can lead to a range of pregnancy pathologies. The objective of this study was to explore the role of N-myc downregulated gene 1 (NDRG1)
Zhi-Yan Hu et al.
Biochimica et biophysica acta, 1852(9), 1876-1886 (2015-06-15)
N-myc downstream-regulated gene 1 (NDRG1) has been implicated in tumorigenesis and metastasis in different cancers. However, its role in nasopharyngeal carcinoma remains unknown. We found that NDRG1 expression level was high in nasopharyngeal cancer 5-8F cells but low in 5-8F-LN
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique