Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU081781

Sigma-Aldrich

MISSION® esiRNA

targeting human ST3GAL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGTGGACCCTATGCTGGAGAAGAGGTCGGTGGGCTGCCGGCGCTGCGCCGTTGTGGGCAACTCGGGCAACCTGAGGGAGTCTTCTTATGGGCCTGAGATAGACAGTCACGACTTTGTCCTCAGGATGAACAAGGCGCCCACGGCAGGGTTTGAAGCTGATGTTGGGACCAAGACCACCCACCATCTGGTGTACCCTGAGAGCTTCCGGGAGCTGGGAGATAATGTCAGCATGATCCTGGTGCCCTTCAAGACCATCGACTTGGAGTGGGTGGTGAGCGCCATCACCACGGGCACCATTTCCCACACCTACATCCCGGTTCCTGCAAAGATCAGAGTGAAACAGGATAAGATCCTGATCTACCACCCAGCCTTCATCAAGTATGTCTTTGACAACTGGCTGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tan-Chi Fan et al.
Cancer letters, 434, 184-195 (2018-07-25)
GFRA1 and RET are overexpressed in estrogen receptor (ER)-positive breast cancers. Binding of GDNF to GFRA1 triggers RET signaling leading to ER phosphorylation and estrogen-independent transcriptional activation of ER-dependent genes. Both GFRA1 and RET are membrane proteins which are N-glycosylated
Wen-Der Lin et al.
Cancer immunology research, 9(1), 113-122 (2020-11-13)
Altered glycosylations, which are associated with expression and activities of glycosyltransferases, can dramatically affect the function of glycoproteins and modify the behavior of tumor cells. ST3GAL1 is a sialyltransferase that adds sialic acid to core 1 glycans, thereby terminating glycan

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique