Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU078751

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATCTGCACCATTGATGTCTACATGATCATGGTCAAATGTTGGATGATTGACTCTGAATGTCGGCCAAGATTCCGGGAGTTGGTGTCTGAATTCTCCCGCATGGCCAGGGACCCCCAGCGCTTTGTGGTCATCCAGAATGAGGACTTGGGCCCAGCCAGTCCCTTGGACAGCACCTTCTACCGCTCACTGCTGGAGGACGATGACATGGGGGACCTGGTGGATGCTGAGGAGTATCTGGTACCCCAGCAGGGCTTCTTCTGTCCAGACCCTGCCCCGGGCGCTGGGGGCATGGTCCACCACAGGCACCGCAGCTCATCTACCAGGAGTGGCGGTGGGGACCTGACACTAGGGCTGGAGCCCTCTGAAGAGGAGGCCCCCAGGTCTCCACTGGCACCCTCCGAAGGGGCTGGCTCCGATGTATTTGATGGTGACCTGGGAAT

Numéro d'accès Ensembl | humain

ENSG00000141736

Numéro d'accès NCBI

NM_004448

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ERBB2(2064) , ERBB2(2064)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yiseul Choi et al.
World journal of gastroenterology, 22(41), 9141-9153 (2016-11-30)
To investigated the relationships between HER2, c-Jun N-terminal kinase (JNK) and protein kinase B (AKT) with respect to metastatic potential of HER2-positive gastric cancer (GC) cells. Immunohistochemistry was performed on tissue array slides containing 423 human GC specimens. Using HER2-positve
Tong Shu et al.
Cancer letters, 411, 65-73 (2017-10-11)
Resistance to platinum-based chemotherapy is a major cause of treatment failure in patients with epithelial ovarian cancer and predicts a poor prognosis. Previously, we found that HECTD3 confers cancer cell resistance to apoptosis. However, the significance of HECTD3 expression in
Nehal Gupta et al.
Scientific reports, 9(1), 5066-5066 (2019-03-27)
Paclitaxel is a first line chemotherapeutic agent for the patients with metastatic breast cancer. But inherited or acquired resistance to paclitaxel leads to poor response rates in a majority of these patients. To identify mechanisms of paclitaxel resistance, we developed
T-T Yu et al.
European review for medical and pharmacological sciences, 24(10), 5267-5280 (2020-06-05)
To explore possible mechanism of ERBB2 gene expression silencing mediating mitogen-activated protein kinase 1/mitogen-activated protein kinase 3 (MAPK1/MAPK3) signaling pathway on proliferation, migration, and invasion of ovarian cancer cells. A total of 240 cancer specimens were collected in patients with
Tiia Honkanen et al.
International journal of oncology, 51(2), 599-606 (2017-06-29)
We have previously shown that cancer stem-like cells (CSLCs) can mediate therapy resistance in ALK translocated lung cancers. HER2 has been linked to CSLCs in breast cancers and, therefore, we wanted to assess whether HER2 has a role in CSLCs
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique