Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU077951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARPC2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG

Numéro d'accès Ensembl | humain

ENSG00000163466

Numéro d'accès NCBI

NM_005731

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ARPC2(10109) , ARPC2(10109)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yae Jin Yoon et al.
Biochemical pharmacology, 163, 46-59 (2019-02-03)
Metastasis is the leading cause of cancer mortality and cancer cell migration is an essential stage of metastasis. We identified benproperine (Benp, a clinically used antitussive drug) as an inhibitor of cancer cell migration and an anti-metastatic agent. Benp selectively
Zhongle Cheng et al.
Oncology reports, 41(6), 3189-3200 (2019-04-20)
Actin-related protein 2/3 complex (ARPC2) is an actin‑binding component involved in the regulation of actin polymerization. It mediates the formation of branched actin networks and contacts the mother actin filament. Migration and invasion are key processes which enable tumor cells
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique