Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU077721

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAAGAGCAAATGGCCTACCTCCAACAGAAAGAGCTGGACCTGATAGATTATAAATTTGGAGAACGTAAAAAAGATGGTGATCCAGATTCCCAGGAACAACAGTTACTGGATTTCTCTGAACCCGACTGTCCCTCTTCATCTGCAAACAGTAGAAAAGACAAGTCTCTGAGAATTATGAGCCAGAAGTTTGTCATGCTGTTCCTCGTCTCCAAAACCAAGATTGTCACTCTGGATGTGGCTGCCAAAATACTGATAGAAGAAAGCCAAGATGCCCCAGACCATAGTAAATTTAAAACAAAGGTACGACGCCTCTATGACATAGCCAATGTTCTGACCAGCTTGGCTCTGATAAAGAAAGTGCATGTAACAGAAGAGCGAGGTCGTAAACCAGCCTTCAAGTGGATC

Numéro d'accès Ensembl | humain

ENSG00000165891

Numéro d'accès NCBI

NM_203394

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... E2F7(144455) , E2F7(144455)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Rui Yang et al.
British journal of cancer, 123(9), 1445-1455 (2020-08-21)
E2F transcription factors are considered to be important drivers of tumour growth. E2F7 is an atypical E2F factor, and its role in glioblastoma remains undefined. E2F7 expression was examined in patients by IHC and qRT-PCR. The overall survival probability was
Weihong Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 104, 94-101 (2018-05-18)
Colorectal cancer (CRC) is one of the most common malignancies with high morbidity and mortality rates worldwide. This study aimed to investigate whether miR-3666 was involved in inhibitory effects of all-transretinoic acid (ATRA) on the development of colorectal cancer (CRC).
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique