Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU074811

Sigma-Aldrich

MISSION® esiRNA

targeting human WHRN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAGGCCTTCAAGACTAAGGACCGTGACTACATTGACTTTCTGGTCACTGAGTTCAATGTGATGCTCTAGAGGCCAAGGCCTGAGGGCCTCCCACCACTGCCCAGCCCCTGGTCCCAGTCCCTTTCCACCGTTGGCTTCATCAAGCTCCTTGCGGGGTTGGGGCTGCATGGCCAGGGTGGCAGGAAGACATCCCCCCTCCATCCCAGCCCACTGGACCAGAACTGGGAGAGGAAGAGAGCAGGACAAGGCAGACAGAAGGTCAGGTCAGGAACTGGTGCTGTACTGGGTACACAGTAGGCGCCCAGGACAAGTGGGTTGCAAGACAGGAAGAAAGGAAAAGGAAGGGCAGAGTGCTGGTTTCTCCAGGTTGGGTTGGGGGCACTGCTGTCCCCCCTCCAGCTAGGACCCAGCCCATCCCCAGATGCCTGAGCCTTTGTCCAAAGTGA

Numéro d'accès Ensembl | humain

ENSG00000095397

Numéro d'accès NCBI

NM_001083885

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... WHRN(25861) , DFNB31(25861)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fernanda C Teixeira et al.
Pharmaceutical development and technology, 25(4), 408-415 (2019-12-19)
Introduction: Glioblastoma (GB) is the most common malignant brain tumor and is characterized by high invasiveness, poor prognosis, and limited therapeutic options. Silencing gene expression, through the use of small interfering RNA (siRNA), has been proposed as an alternative to
Wuming Gong et al.
BMC bioinformatics, 7, 516-516 (2006-11-30)
Short interfering RNAs have allowed the development of clean and easily regulated methods for disruption of gene expression. However, while these methods continue to grow in popularity, designing effective siRNA experiments can be challenging. The various existing siRNA design guidelines
Avraam El Hamidieh et al.
PloS one, 7(8), e42722-e42722 (2012-08-23)
Cdc37 is a 50 kDa molecular chaperone which targets intrinsically unstable protein kinases to the molecular chaperone HSP90. It is also an over-expressed oncoprotein that mediates carcinogenesis and maintenance of the malignant phenotype by stabilizing the compromised structures of mutant
Shun Yao et al.
Cancer letters, 502, 1-8 (2020-12-07)
Angio-associated migratory cell protein (AAMP) is considered a pro-tumor protein, which contributes to angiogenesis, proliferation, adhesion, and other biological activities. Although AAMP is known to facilitate the motility of breast cancer cells and smooth muscle cells by regulating ras homolog
Ya-Jie Zhang et al.
World journal of gastroenterology, 20(25), 8229-8236 (2014-07-11)
To investigate the effect of Girdin knockdown on the chemosensitivity of colorectal cancer cells to oxaliplatin and the possible mechanisms involved. Four siRNAs targeting Girdin were transfected into the chemoresistant colorectal cancer cell line DLD1. Real-time polymerase chain reaction (PCR)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique