Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU074571

Sigma-Aldrich

MISSION® esiRNA

targeting human VHL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATCTGGAAGACCACCCAAATGTGCAGAAAGACCTGGAGCGGCTGACACAGGAGCGCATTGCACATCAACGGATGGGAGATTGAAGATTTCTGTTGAAACTTACACTGTTTCATCTCAGCTTTTGATGGTACTGATGAGTCTTGATCTAGATACAGGACTGGTTCCTTCCTTAGTTTCAAAGTGTCTCATTCTCAGAGTAAAATAGGCACCATTGCTTAAAAGAAAGTTAACTGACTTCACTAGGCATTGTGATGTTTAGGGGCAAACATCACAAAATGTAATTTAATGCCTGCCCATTAGAGAAGTATTTATCAGGAGAAGGTGGTGGCATTTTTGCTTCCTAGTAAGTCAGGACAGCTTGTATGTAAGGAGGTTTGTATAAGTAATTCAGTGGGAATTGCAGCATA

Numéro d'accès Ensembl | humain

ENSG00000134086

Numéro d'accès NCBI

NM_198156

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VHL(7428) , VHL(7428)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jie Hao et al.
Neurochemical research, 41(9), 2391-2400 (2016-06-22)
The VHL (Von Hippel-Lindau) gene is a tumor suppressor gene, which is best known as an E3 ubiquitin ligase that negatively regulates the hypoxia inducible factor. The inactivation of VHL gene could result in the abnormal synthesis of VHL protein
Yinghong Zhou et al.
Oxidative medicine and cellular longevity, 2020, 7079308-7079308 (2020-04-11)
Hepatocellular carcinoma (HCC) is regarded as a leading cause of cancer-related deaths, and its progression is associated with hypoxia and the induction of hypoxia-inducible factor (HIF). Meloxicam, a selective cyclooxygenase-2 (COX-2) inhibitor, induces cell death in various malignancies. However, the
Susan E Scanlon et al.
Oncotarget, 9(4), 4647-4660 (2018-02-13)
The von Hippel-Lindau (
Dawei Li et al.
Free radical biology & medicine, 110, 102-116 (2017-06-07)
Oxidative stress has a critical role in the pathogenesis of acetaminophen (APAP) induced hepatocellular necrosis, and the identification of novel approaches to attenuate oxidative stress is essential to prevent/revert the disease. This study investigated the role of both HIF-1 and
Mian Wei et al.
Journal of cellular physiology, 234(10), 17392-17404 (2019-02-23)
Microenvironmental hypoxia-mediated drug resistance is responsible for the failure of cancer therapy. To date, the role of the hedgehog pathway in resistance to temozolomide (TMZ) under hypoxia has not been investigated. In this study, we discovered that the increasing hypoxia-inducible
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique