Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU067921

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM22

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGAGCTCCTGAGTGTTCTCATTCCTTTACCCACTTCTGCATAGTAGCCCTTGTGCTGAGACTCAGATTCTGCACCTGAGTTCATCTCTACTGAGACCATCTCTTCCTTTCTTTCCCCTTCTTTTACTTAGAATGTCTTTGTATTCATTTGCTAGGGCTTCCATAGCAAAGCATCATAGATTGCTGATTTAAACTGTAATTGTATTGCCGTACTGTGGGCTGGAAATCCCAAATCTAGATTCCAGCAGAGTTGGTTCTTTCTGAGGTCTGCAAGGAAGGGCTCTGTTCCATGCCTCTCTCCTTGGCTTGTAGAAGGCATCTTGTCCCTATGACTCTTCACATTGTCTTTATGTACATCTCTGTGCCCAAGTTTTCCCTTTTTATTAAGACACCAGTCATACTGGCTCAGGGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li Liu et al.
Oncotarget, 8(37), 62069-62080 (2017-10-06)
Expression pattern and biological roles of TRIM22 remains unknown in most human cancers. The present study aims to discover its clinical significance and function in human non-small cell lung cancer (NSCLC). Immunohistochemistry was used to examine TRIM22 expression in 126
Chen Yang et al.
Cellular & molecular immunology, 13(1), 94-102 (2015-02-17)
TRIM22, a tripartite-motif (TRIM) protein, is upregulated upon interferon alpha (IFNα) administration to hepatitis C virus (HCV)-infected patients. However, the physiological role of TRIM22 upregulation remains unclear. Here, we describe a potential antiviral function of TRIM22's targeting of the HCV

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique