Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU060131

Sigma-Aldrich

MISSION® esiRNA

targeting human IL17RB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGATGCCACTGCTTTCTGTGCAGAACTTCTCCATGTCAAGCAGCAGGTGTCAGCAGGAAAAAGATCACAAGCCTGCCACGATGGCTGCTGCTCCTTGTAGCCCACCCATGAGAAGCAAGAGACCTTAAAGGCTTCCTATCCCACCAATTACAGGGAAAAAACGTGTGATGATCCTGAAGCTTACTATGCAGCCTACAAACAGCCTTAGTAATTAAAACATTTTATACCAATAAAATTTTCAAATATTGCTAACTAATGTAGCATTAACTAACGATTGGAAACTACATTTACAACTTCAAAGCTGTTTTATACATAGAAATCAATTACAGTTTTAATTGAAAACTATAACCATTTTGATAATGCAACAATAAAGCATCTTCAGCCAAACATCTAGTCTTCCATAGACCATGCATTGCAG

Numéro d'accès Ensembl | humain

ENSG00000056736

Numéro d'accès NCBI

NM_018725

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IL17RB(55540) , IL17RB(55540)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yong-Sheng Teng et al.
Cell death & disease, 10(2), 79-79 (2019-01-30)
Interleukin-17 receptor B (IL-17RB), a member of the IL-17 receptor family activated by IL-17B/IL-17E, has been shown to be involved in inflammatory diseases. However, the regulation and function of IL-17RB in Helicobacter pylori (H. pylori) infection, especially in the early-phase
Suxun Pan et al.
Cell biology international, 44(11), 2220-2230 (2020-07-28)
Interleukin-25 (IL-25) has been recognized as a new member of the IL-17 family and implicated in various inflammatory pathology. We aimed to investigate the effects of IL-25 on the expression of matrix metalloproteinase-2 (MMP-2), MMP-8, and MMP-9 in periodontal fibroblast
Lei Ren et al.
Molecular immunology, 90, 126-135 (2017-07-18)
IL-17RB, a member of the IL-17 receptor family that can be activated by IL-17B, has been proved to be involved in inflammatory diseases and cancers. However, the function of IL-17RB in thyroid cancer is still unknown. In this study, IL-17RB

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique