Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU046331

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGACCAGTGTCAGGCAGGGGCCAGCCCCTCAGCCCCTGAGCCAAGGGGGAAAAGAAGAAAAAGTACCTAACACAAGCTTCCTTTTTGCACAACCGGTCCTCTTGGCTGAGGAGGAGGAGCTGGTCACCCTGGCTGCACAGTTAGAGAGGGGAGAAGGAACCCATGATGGGACTCCTGGGGTAGGGGCCAGGGGCTGGGGTCTGCTGGGGACAGGTCTCTCTGGGACAGACCTCAGAGATTGTGAATGCAGTGCCA

Numéro d'accès Ensembl | humain

ENSG00000161798

Numéro d'accès NCBI

NM_001651

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... AQP5(362) , AQP5(362)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Michihiro Kudou et al.
International journal of oncology, 50(5), 1857-1867 (2017-03-31)
Previous studies described that the expression of aquaporin 5 (AQP5) was altered in tumors of various organs. AQP5 is attracting attention as a new cancer therapeutic target. In the present study, heat shock-induced changes in AQP5 expression were evaluated by
Chen Chen et al.
Molecular carcinogenesis, 56(12), 2692-2705 (2017-08-24)
Epithelial-mesenchymal transition (EMT) has emerged as an important determinant role in colorectal cancer (CRC) metastasis. It has been reported that aquaporin 5 (AQP5) is closely linked to CRC metastasis. However, the effect of AQP5 on the EMT process of CRC
Xueqing Li et al.
OncoTargets and therapy, 11, 3359-3368 (2018-06-21)
Based on the functionality of AQP-5 characterized in various physiological processes, our study aimed to investigate the effect of AQP-5 silencing by siRNA interference on chemosensitivity of breast cancer cells. The expression levels of AQP-5 mRNA in different experimental groups
ChunXiao Yan et al.
Journal of ovarian research, 7, 78-78 (2014-10-10)
Recent studies suggested that aquaporins 5 (AQP5) was associated with many kinds of cancers and regulated many processes of various kinds of cancer cells. Our previous studies also demonstrated that AQP5 was highly expressed in epithelial ovarian cancer and contributed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique