Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU038011

Sigma-Aldrich

MISSION® esiRNA

targeting human IFNAR1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCGTACAAGCATCTGATGGAAATAACACATCTTTTTGGTCTGAAGAGATAAAGTTTGATACTGAAATACAAGCTTTCCTACTTCCTCCAGTCTTTAACATTAGATCCCTTAGTGATTCATTCCATATCTATATCGGTGCTCCAAAACAGTCTGGAAACACGCCTGTGATCCAGGATTATCCACTGATTTATGAAATTATTTTTTGGGAAAACACTTCAAATGCTGAGAGAAAAATTATCGAGAAAAAAACTGATGTTACAGTTCCTAATTTGAAACCACTGACTGTATATTGTGTGAAAGCCAGAGCACACACCATGGATGAAAAGCTGAATAAAAGCAGTGTTTTTAGTGACGCTGTATGTGAGAAAACAAAACCAGGAAATACCTCTAAAATTTGGCTTATAGTTGGAATTTGTATTGCATTATTTGCTCTCCCGTTTGTCATTTATGCTGCGAAAGTCTTCTTGA

Numéro d'accès Ensembl | humain

ENSG00000142166

Numéro d'accès NCBI

NM_000629

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IFNAR1(3454) , IFNAR1(3454)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Peng Li et al.
Brain, behavior, and immunity, 79, 174-185 (2019-02-04)
Neuroinflammation occurs after germinal matrix hemorrhage (GMH) and induces secondary brain injury. Interferon-α (IFN-α) has been shown to exert anti-inflammatory effects in infectious diseases via activating IFNAR and its downstream signaling. We aimed to investigate the anti-inflammatory effects of Recombinant
Atsushi Hamana et al.
Human gene therapy, 27(11), 936-945 (2016-08-09)
Gene therapy techniques aiming to induce the long-term interferon-β (IFN-β) expression are desirable for inhibiting cancer growth. However, there has been no success in this regard because IFN-β significantly inhibits transgene expression. This study used the IFN-inducible Mx promoter to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique