Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU030731

Sigma-Aldrich

MISSION® esiRNA

targeting human NEU3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAACCCAAGCCAATTCAAAAGCAATTAATTGGCTTAGGACCCAATTTCCATAGATGCAAATGGCAGTTACAGACAGGTTAACAGAAGCTACTGAAGTCTACAGATAATCAAAAAACTTAATATTCTGTTCCCTACCTTTTTTCACTTTTCCTCCTCCAAAGAGCAAAATGAAAATTTTGCCTTAGCTACTGCAGTGGAAAGAGCACTGAACTAGGAGTTGGAAGACAAGGATGTGGTCCTGGCTCTGCCACTGGCTTGCTTTTGGACCTTGGATGTGTCACCTGAACTCTCTGGACCTCAGGTTTCCATCTGTAAAATGAGAGTATTGGTTCTAAGATTTCTCATCTTCTCATCCCTAGGACAAGCATAGTGCCTGCATGCTTCATGATCAGTAAGTCCTGGCTGCATAAAGGA

Numéro d'accès Ensembl | humain

ENSG00000162139

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NEU3(10825) , NEU3(10825)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Md Amran Howlader et al.
ACS chemical biology, 15(6), 1328-1339 (2020-04-21)
The human neuraminidase enzymes (NEU1, NEU2, NEU3, and NEU4) are a class of enzymes implicated in pathologies including cancer and diabetes. Several reports have linked neuraminidase activity to the regulation of cell migration in cancer cells. Using an in vitro
Kazuhiro Shiozaki et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(5), 2099-2111 (2015-02-14)
The plasma membrane-associated sialidase NEU3 plays crucial roles in regulation of transmembrane signaling, and its aberrant up-regulation in various cancers contributes to malignancy. However, it remains uncertain how NEU3 is naturally activated and locates to plasma membranes, because of its

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique