Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU019581

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2C

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCTCCTCAGCTCTACGTCTAAATACAAAGTGACAGTGGCTGAAGTACAGAGGCGACTGTCCCCACCTGAATGCTTAAATGCCTCGTTACTGGGAGGTGTTCTCAGAAGAGCCAAATCGAAAAATGGAGGCCGGTCCTTGCGGGAGAAGTTGGACAAGATTGGGTTGAATCTTCCGGCCGGGAGGCGGAAAGCCGCTCATGTGACTCTCCTGACATCCTTAGTAGAAGGTGAAGCTGTTCATTTGGCTAGGGACTTTGCCTATGTCTGTGAAGCCGAATTTCCTAGTAAACCAGTGGCAGAATATTTAACCAGACCTCATCTTGGAGGACGAAATGAGATGGCAGCTAGGAAGAACATGCTATTGGCGGCCCAGCAACTGTGTAAAGAATTCACAGAACTTCTCAGCCAAGACCGGACACCCCATGGGACCAGCAGGCTCGCCCCAGTCTTGGAGACGAACATACAGAACTGCTTGTCTCATTTCAGCCTGATTACCCACG

Numéro d'accès Ensembl | humain

ENSG00000087510

Numéro d'accès NCBI

NM_003222

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TFAP2C(7022) , TFAP2C(7022)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

J Kang et al.
Oncogene, 36(11), 1585-1596 (2016-09-07)
Non-small cell lung cancer (NSCLC) remains one of the leading causes of death worldwide, and thus new molecular targets need to be identified to improve treatment efficacy. Although epidermal growth factor receptor (EGFR)/KRAS mutation-driven lung tumorigenesis is well understood, the
Wanyeon Kim et al.
Experimental & molecular medicine, 48(11), e273-e273 (2016-11-26)
TFAP2C (transcription factor-activating enhancer-binding protein 2C) expression has been positively correlated with poor prognosis in patients with certain types of cancer, but the mechanisms underlying TFAP2C-mediated tumorigenesis in non-small-cell lung cancer (NSCLC) are still unknown. We previously performed a microarray
Lingjie Li et al.
Cell stem cell, 24(2), 271-284 (2019-01-29)
Tissue development results from lineage-specific transcription factors (TFs) programming a dynamic chromatin landscape through progressive cell fate transitions. Here, we define epigenomic landscape during epidermal differentiation of human pluripotent stem cells (PSCs) and create inference networks that integrate gene expression
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique