Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU008631

Sigma-Aldrich

MISSION® esiRNA

targeting human USP37

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAGGTTCAGCACTCCATCATTTGTAAAGCATGTGGAGAGATTATCCCCAAAAGAGAACAGTTTAATGACCTCTCTATTGACCTTCCTCGTAGGAAAAAACCACTCCCTCCTCGTTCAATTCAAGATTCTCTTGATCTTTTCTTTAGGGCCGAAGAACTGGAGTATTCTTGTGAGAAGTGTGGTGGGAAGTGTGCTCTTGTCAGGCACAAATTTAACAGGCTTCCTAGGGTCCTCATTCTCCATTTGAAACGATATAGCTTCAATGTGGCTCTCTCGCTTAACAATAAGATTGGGCAGCAAGTCATCATTCCAAGATACCTGACCCTGTCATCTCATTGCACTGAAAATACAAAACCACCTTTTACCCTTGGTTGGAGTGCACATATGGCAATTTCTAGACCATTGAAAGCCTCTCAAATGGTGAATTCCTGCA

Numéro d'accès Ensembl | humain

ENSG00000135913

Numéro d'accès NCBI

NM_020935

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... USP37(57695) , USP37(57695)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Debjani Pal et al.
Cell death & disease, 11(4), 298-298 (2020-04-30)
APC/CCdh1 is a ubiquitin ligase with roles in numerous diverse processes, including control of cellular proliferation and multiple aspects of the DNA damage response. Precise regulation of APC/CCdh1 activity is central to efficient cell-cycle progression and cellular homeostasis. Here, we
Seok Kim et al.
Cancers, 11(3) (2019-03-14)
WP1130, a partially selective deubiquitinases (DUB) inhibitor, inhibits the deubiquitinating activities of USP5, USP9X, USP14, USP37, and UCHL1. In this study, we investigate whether WP1130 exerts sensitizing effect on TNF-related apoptosis-inducing ligand (TRAIL)-induced apoptosis in human renal carcinoma cells. Combinations
Zhenna Xiao et al.
American journal of cancer research, 9(12), 2749-2759 (2020-01-09)
SNAI1, an epithelial-mesenchymal transition (EMT)-inducing transcription factor, promotes tumor metastasis and resistance to apoptosis and chemotherapy. SNAI1 protein levels are tightly regulated by proteolytic ubiquitination. Here, we identified USP37 as a SNAI1 deubiquitinase that removes the polyubiquitination chain from SNAI1

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique