Skip to Content
Merck
All Photos(1)

Key Documents

EHU130851

Sigma-Aldrich

MISSION® esiRNA

targeting human EGF

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCGAGAAAGGCTTATTGAGGAAGGAGTAGATGTGCCAGAAGGTCTTGCTGTGGACTGGATTGGCCGTAGATTCTATTGGACAGACAGAGGGAAATCTCTGATTGGAAGGAGTGATTTAAATGGGAAACGTTCCAAAATAATCACTAAGGAGAACATCTCTCAACCACGAGGAATTGCTGTTCATCCAATGGCCAAGAGATTATTCTGGACTGATACAGGGATTAATCCACGAATTGAAAGTTCTTCCCTCCAAGGCCTTGGCCGTCTGGTTATAGCCAGCTCTGATCTAATCTGGCCCAGTGGAATAACGATTGACTTCTTAACTGACAAGTTGTACTGGTGCGATGCCAAGCAGTCTGTGATTGAAATGGCCAATCTGGATGGTTCAAAACGCCGAAGACTTACCCAGAATGATGTAGGTCACCCATTTGCTGTAGCAGTGTTTGAGGATTATGTGTGGTTCTCAGATTGGGCTATGCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mingli Duan et al.
Molecular medicine reports, 18(2), 1651-1659 (2018-05-31)
Migration and invasion are the most important characteristics of human malignancies which limit cancer drug therapies in the clinic. Tongue squamous cell carcinoma (TSCC) is one of the rarest types of cancer, although it is characterized by a higher incidence
Pengfei Liu et al.
Life sciences, 230, 45-54 (2019-05-28)
The action of cell-based therapy against acute kidney injury (AKI) has been demonstrated by different groups for years. However, which kind of cells hold best therapeutic effect remains unclear. In this study, we mainly explored whether human placental trophoblast cells
Ding Zhang et al.
Clinical and translational medicine, 10(8), e231-e231 (2020-12-31)
Acute lung injury is a serious form and major cause of patient death and still needs efficient therapies. The present study evidenced that co-transplantation of mesenchymal stem cells (MSCs) and telocytes (TCs) improved the severity of experimental lung tissue inflammation
Cuijie Li et al.
Journal of cellular physiology, 236(4), 2881-2892 (2020-11-25)
Intestinal mucosal injury is one of the most significant complications of burns. In our previous study, it was found that autophagy could alleviate burn-induced intestinal injury, but the underlying mechanisms are still unclear. Irregular expression of long noncoding RNAs (lncRNAs)
Ying-Hsia Shih et al.
Oncotarget, 6(18), 16601-16610 (2015-06-13)
Colorectal adenocarcinoma is a common cause death cancer in the whole world. The aim of this study is to define the 111In-cetuximab as a diagnosis tracer of human colorectal adenocarcinoma. In this research, cell uptake, nano-SPECT/CT scintigraphy, autoradiography, biodistribution and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service