Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EMU069661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Becn1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCCAATAAGATGGGTCTGAAGTTTCAGAGGTACCGACTTGTTCCCTATGGAAATCATTCCTATCTGGAGTCTCTGACAGACAAATCTAAGGAGTTGCCGTTATACTGTTCTGGGGGTTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTAGCTTTTCTGGACTGTGTGCAGCAGTTCAAAGAAGAGGTGGAAAAAGGAGAGACTCGATTTTGTCTTCCGTACAGGATGGACGTGGAGAAAGGCAAGATTGAAGACACTGGAGGCAGTGGCGGCTCCTATTCCATCAAAACCCAGTTTAACTCGGAGGAGCAGTGGACAAAAGCGCTCAAGTTCATGCTGACCAATCTCAAGTGGGGTCTTGCCTGGGTGTCCTCACAGTTCTATAACAAGTGACTTGCTCCTTAGGGGATGTTTG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000035086

NCBI-Hinterlegungsnummer

NM_019584

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... BECN1(56208) , Becn1(56208)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ge Niu et al.
The Journal of biological chemistry, 290(29), 18102-18110 (2015-06-10)
One of the fundamental functions of molecular chaperone proteins is to selectively conjugate cellular proteins, targeting them directly to lysosome. Some of chaperones, such as the stress-induced Hsp70, also play important roles in autophagosome-forming macroautophagy under various stress conditions. However
Yusra Al Dhaheri et al.
PloS one, 9(10), e109630-e109630 (2014-10-10)
In this study we investigated the in vitro and in vivo anticancer effect of carnosol, a naturally occurring polyphenol, in triple negative breast cancer. We found that carnosol significantly inhibited the viability and colony growth induced G2 arrest in the
Xing-guo Zhao et al.
PloS one, 10(4), e0126147-e0126147 (2015-04-30)
Hypopharyngeal squamous cell carcinoma (HSCC) has the worst prognosis among head and neck cancers. Cisplatin (DDP)-based chemotherapy is an important part of multimodal treatments. However, resistance to DDP severely impairs the effectiveness of chemotherapy for HSCC. Chloroquine (CQ) has been
Pujika Emani Munasinghe et al.
International journal of cardiology, 202, 13-20 (2015-09-20)
Diabetes promotes progressive loss of cardiac cells, which are replaced by a fibrotic matrix, resulting in the loss of cardiac function. In the current study we sought to identify if excessive autophagy plays a major role in inducing this progressive
Tiina Öhman et al.
Journal of immunology (Baltimore, Md. : 1950), 192(12), 5952-5962 (2014-05-09)
Dectin-1 is a membrane-bound pattern recognition receptor for β-glucans, which are the main constituents of fungal cell walls. Detection of β-glucans by dectin-1 triggers an effective innate immune response. In this study, we have used a systems biology approach to
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.