Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU161041

Sigma-Aldrich

MISSION® esiRNA

targeting human GPBAR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGGGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCGTCCAGCTCAGCCATCCAGCCTGTCTCTACC

Ensembl | Human Hinterlegungsnummer

ENSG00000179921

NCBI-Hinterlegungsnummer

NM_001077191

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... GPBAR1(151306) , GPBAR1(151306)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hui Liang et al.
Journal of neuroinflammation, 18(1), 40-40 (2021-02-04)
Nucleotide-binding oligomerization domain-like receptor pyrin domain-containing protein 3 (NLRP3) plays an important role in mediating inflammatory responses during ischemic stroke. Bile acid receptor Takeda-G-protein-receptor-5 (TGR5) has been identified as an important component in regulating brain inflammatory responses. In this study
Ai-Di Li et al.
Experimental cell research, 389(2), 111855-111855 (2020-01-25)
Takeda-G-protein-receptor-5 (TGR5) is a G-protein-coupled receptor (GPCR) activated by bile acids, and mortalin is a multipotent chaperone of the HSP70 family. In the present study, TGR5 was detected by immunohistochemistry (IHC) in extrahepatic cholangiocarcinoma (ECC) specimens, and TGR5 expression in
Yu Chen et al.
International immunopharmacology, 71, 144-154 (2019-03-23)
NLRP3 inflammasome has been reported to be associated with inflammatory bowel disease including colitis due to its potential ability to induce IL-1β secretion. Emerging studies have demonstrated that Genistein, a major isoflavone, has potential anti-inflammatory effects in murine model colitis.
You-Chao Qi et al.
Chinese journal of natural medicines, 18(12), 898-906 (2020-12-29)
Taurochenodeoxycholic acid (TCDCA) is one of the main effective components of bile acid, playing critical roles in apoptosis and immune responses through the TGR5 receptor. In this study, we reveal the interaction between TCDCA and TGR5 receptor in TGR5-knockdown H1299
Haiming Xiao et al.
Pharmacological research, 151, 104559-104559 (2019-11-24)
Our previous studies indicated that the G-protein-coupled bile acid receptor, Gpbar1 (TGR5), inhibits inflammation by inhibiting the NF-κB signalling pathway, eventually attenuating diabetic nephropathy (DN). Gentiopicroside (GPS), the main active secoiridoid glycoside of Gentiana manshurica Kitagawa, has been demonstrated to
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.