Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU137921

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCCAAATTCATGGGAGTTCAAATGGAGACTTTTATGTTACATTATCAGGACCTGCTGCAGCTACAGTATGAAGGAGTTGCAGTCATGAAATTATTTGATAGAGCTAAAGTAAATGTCAACCTCCTGATCTTCCTTCTCAACAAAAAGTTCTACGGGAAGTAATTGATCGTTTGCTGCCAGCCCAGAAGGATGAAGGAAAGAAGCACCTCACAGCTCCTTTCTAGGTCCTTCTTTCCTCATTGGAAGCAAAGACCTAGCCAACAACAGCACCTCAATCTGATACACTCCCGATGCCACATTTTTAACTCCTCTCGCTCTGATGGGACATTTGTTACCCTTTTTTCATAGTGAAATTGTGTTTCAGGCTTAGTCTGACCTTTCTGGTTTCTTCATTTTCTTCCATTACTTAGGAAAGAGTGGAAACTCCACTAAAATTTCTCTGTGTTGTTACAGTCTTAGAGGTTGCAGTACTATATTGTAAGCTTTGGTGTTTGTTTAATTAGCAATAGGGATGGTAGGATTCA

Ensembl | Human Hinterlegungsnummer

ENSG00000140575

NCBI-Hinterlegungsnummer

NM_003870

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IQGAP1(8826) , IQGAP1(8826)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoxia Wang et al.
The International journal of biological markers, 33(1), 73-78 (2017-07-15)
Laryngeal squamous cell carcinoma (LSCC) has a poor prognosis due to recurrence and metastasis. IQ-domain GTPase-activating protein 1 (IQGAP1), a scaffold protein, plays an important role in tumorigenesis and malignant development. In this study, we aimed to explore the role
Shihong Su et al.
DNA and cell biology, 39(7), 1127-1140 (2020-05-05)
Pulmonary microvascular endothelium barrier plays a critical role in protecting the pulmonary tissue from inflammatory injury in acute respiratory distress syndrome and acute lung injury (ARDS/ALI). The dysregulation of IQ-GTPase-activating protein 1 (IQGAP1) was an important etiology of endothelium barrier
Bhavna Chawla et al.
The Journal of biological chemistry, 292(8), 3273-3289 (2017-01-14)
Insulin binds to the insulin receptor (IR) and induces tyrosine phosphorylation of the receptor and insulin receptor substrate-1 (IRS-1), leading to activation of the PKB/Akt and MAPK/ERK pathways. IQGAP1 is a scaffold protein that interacts with multiple binding partners and
Niramol Jitprasutwit et al.
Journal of proteome research, 15(12), 4675-4685 (2016-12-10)
Intracellular actin-based motility of the melioidosis pathogen Burkholderia pseudomallei requires the bacterial factor BimA. Located at one pole of the bacterium, BimA recruits and polymerizes cellular actin to promote bacterial motility within and between cells. Here, we describe an affinity
Aaron M Tocker et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2896-2909 (2017-09-03)
Sensing of cytosolic nucleotides is a critical initial step in the elaboration of type I IFN. One of several upstream receptors, cyclic GMP-AMP synthase, binds to cytosolic DNA and generates dicyclic nucleotides that act as secondary messengers. These secondary messengers
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.