Direkt zum Inhalt
Merck

EHU131771

Sigma-Aldrich

MISSION® esiRNA

targeting human HAS2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTGGGTGTGTTCAGTGCATTAGTGGACCTCTGGGAATGTACAGAAACTCCTTGTTGCATGAGTTTGTGGAAGATTGGTACAATCAAGAATTTATGGGCAACCAATGTAGCTTTGGTGATGACAGGCATCTCACGAACCGGGTGCTGAGCCTGGGCTATGCAACAAAATACACAGCTCGATCTAAGTGCCTTACTGAAACACCTATAGAATATCTCAGATGGCTAAACCAGCAGACCCGTTGGAGCAAGTCCTACTTCCGAGAATGGCTGTACAATGCAATGTGGTTTCACAAACATCACTTGTGGATGACCTACGAAGCGATTATCACTGGATTCTTTCCTTTCTTTCTCATTGCCACAGTAATCCAGCTCTTCTACCGGGGTAAAATTTGGAACATTCTCCTCTTCTTGTTAACTGTCCAGCTAGTAGGTCTCATAAAATCATCTTTTGCCAGCTGCCTTA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hong Zhan et al.
Fertility and sterility, 114(4), 888-898 (2020-08-09)
To investigate the role(s) of hyaluronan synthase 2 (HAS2) and hyaluronan in disease progression of endometriosis and epidermal growth factor (EGF)-induced motility changes of endometriotic cells. A case-control experimental study and in vitro primary cell culture study. University hospital-affiliated research centers.
Xiaoyan Chen et al.
Cell communication and signaling : CCS, 18(1), 89-89 (2020-06-11)
Hyaluronan (HA) is an abundant component of the bone marrow (BM) extracellular matrix. Here, we investigated the abnormal deposition of HA in the BM microenvironment and its remodelling in mediating the malignancy of breast cancer cells (BCCs). BCCs were transplanted
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
Priscilla Soulié et al.
American journal of physiology. Cell physiology, 307(8), C745-C759 (2014-08-29)
Generation of branched tubes from an epithelial bud is a fundamental process in development. We hypothesized that induction of hyaluronan synthase (Has) and production of hyaluronan (HA) drives tubulogenesis in response to morphogenetic cytokines. Treatment of J3B1A mammary cells with

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.