Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU104281

Sigma-Aldrich

MISSION® esiRNA

targeting human PHB2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGTCAACGAGGTGCTCAAGAGTGTGGTGGCCAAGTTCAATGCCTCACAGCTGATCACCCAGCGGGCCCAGGTATCCCTGTTGATCCGCCGGGAGCTGACAGAGAGGGCCAAGGACTTCAGCCTCATCCTGGATGATGTGGCCATCACAGAGCTGAGCTTTAGCCGAGAGTACACAGCTGCTGTAGAAGCCAAACAAGTGGCCCAGCAGGAGGCCCAGCGGGCCCAATTCTTGGTAGAAAAAGCAAAGCAGGAACAGCGGCAGAAAATTGTGCAGGCCGAGGGTGAGGCCGAGGCTGCCAAGATGCTTGGAGAAGCACTGAGCAAGAACCCTGGCTACATCAAACTTCGCAAGATTCGAGCAGCCCAGAATATCTCCAAGACGATCGCCACATCACAGAATCGTATCTATCTCACAGCTGACAACCTTGTGCTGAACCTACAGGATGAAAGTTTCACCAGGTACAGTGACAGCCTCATCAAGGGT

Ensembl | Human Hinterlegungsnummer

ENSG00000215021

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... PHB2(11331) , PHB2(11331)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ting Huang et al.
Frontiers in immunology, 11, 569173-569173 (2020-10-30)
Mitophagy has recently been implicated in bacterial infection but the underlying mechanism remains largely unknown. Here, we uncover a role of microRNA-302/367 cluster in regulating mitophagy and its associated host response against bacterial infection. We demonstrate that miR-302/367 cluster expression
Heng-Hsiung Wu et al.
Journal of food and drug analysis, 28(1), 183-194 (2019-12-31)
Membranous nephropathy (MN) is the most common cause of nephrotic syndrome in adults, when not effectively treated. The aim of this study was to discover new targets for the diagnosis and treatment of MN. A reliable mouse model of MN
Tongyu Zhang et al.
Stroke, 50(4), 978-988 (2019-03-21)
Background and Purpose- Mitoquinone has been reported as a mitochondria-targeting antioxidant to promote mitophagy in various chronic diseases. Here, our aim was to study the role of mitoquinone in mitophagy activation and oxidative stress-induced neuronal death reduction after subarachnoid hemorrhage
Cristina Moncunill-Massaguer et al.
Oncotarget, 6(39), 41750-41765 (2015-10-27)
We previously described diaryl trifluorothiazoline compound 1a (hereafter referred to as fluorizoline) as a first-in-class small molecule that induces p53-independent apoptosis in a wide range of tumor cell lines. Fluorizoline directly binds to prohibitin 1 and 2 (PHBs), two proteins

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.