Direkt zum Inhalt
Merck

EHU046501

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 3 Wochen (4 bis 6 Wochen bei kundenspez. Bestellungen).

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTGTGAAATCTATTCGAAGTATACCTGCCTACCTTGCAGAGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xujuan Sun et al.
Cell death & disease, 9(6), 637-637 (2018-05-29)
As a calcium-dependent phospholipid binding annexin protein, annexin A5 (Anxa5) links to the progression, metastasis, survival, and prognosis of a variety of cancers. Current work showed ANXA5 overexpression was positively correlated with the upregulations of CRKI/II and RAC1 in hepatocarcinoma
Jian Zhou et al.
Respiratory research, 19(1), 96-96 (2018-05-23)
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors, including gefitinib, are first-line drugs against advanced non-small cell lung cancer with activating EGFR mutations. However, the development of resistance to such drugs is a major clinical challenge. The role of annexin
Nahee Park et al.
Journal of toxicology and environmental health. Part A, 77(22-24), 1467-1476 (2014-10-25)
Auranofin is a lipophilic gold compound with anti-inflammatory and immunosuppressive properties. This compound also exerts antiproliferative effects in several human cancer cell lines. Although auranofin induces apoptosis in human cancer cells, the underlying mechanisms remain unclear. This study investigated auranofin-mediated
Jingjing Wang et al.
Oncology reports, 32(6), 2557-2563 (2014-10-18)
Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin's lymphoma worldwide. Although patient outcomes have significantly improved to a greater than 40% cure rate by the combinatorial cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP) chemotherapy, which is widely

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.